Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rapid identification Internet-of-Things anti-counterfeiting tracing system and anti-counterfeiting tracing method

An Internet of Things and fast technology, which is applied in the field of ginseng identification and anti-counterfeiting, can solve the problems of harm and side effects, and achieve the effect of controlling copying and good anti-counterfeiting means

Inactive Publication Date: 2018-09-04
亳州中药材商品交易中心有限公司
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the chemical ingredients contained in it often have some side effects that are very harmful to the human body

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid identification Internet-of-Things anti-counterfeiting tracing system and anti-counterfeiting tracing method
  • Rapid identification Internet-of-Things anti-counterfeiting tracing system and anti-counterfeiting tracing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Prepare the DNA chip, the specific process is as follows:

[0044] 1. Attach a layer of 150nm metal film on the surface of the silicon chip through the metal coating process, which can be Au or Ag;

[0045] 2. Thiolate the gene fragment of the probe, and then point different thiolated probes to different regions, and keep it at 4°C for 12 hours, wherein the gene probes include the following probes:

[0046] Probe one: GTTCAGTGATATGCTTAACGG;

[0047] Probe two: TGAGGTTCCTACCTGATTCAG;

[0048] Probe three: ATGAATTTTGAAGCCC;

[0049] Probe four: TATAGATAATC;

[0050] Probe five: ATTATAGATACACAC;

[0051] Probe six: GATTCGAGCGTTCAAATGAT;

[0052] 3. Then wash off unbound probes on the surface of the metal film with deionized water, and then blow dry with nitrogen.

[0053] The DNA chip prepared by the above method has good stability and can be circulated in the market for a long time. The DNA probe on the surface is designed for the DNA sequence of ginseng, and some e...

Embodiment 2

[0055] To construct the ginseng DNA database, the specific process is as follows:

[0056] 1. The ginseng sample is extracted by CTAB method, the specific process is as follows: Add 4ml CTAB extract and 80ul mercaptoethanol to the centrifuge tube, preheat it in a water bath at 65±5°C, take the ginseng sample, grind it into powder with liquid nitrogen, and transfer it to the preheated tube. In the heated centrifuge tube, seal it, keep it warm in a water bath at 65±5°C for 30±10 minutes, take out the centrifuge tube, quickly cool down to room temperature, add 4ml of phenol:chloroform:isoamyl alcohol and mix in a ratio of 25:24:1 solution, mix well to form a mixed emulsion; centrifuge at 12000r / min for 10min, take the supernatant, add 4ml of chloroform: isoamyl alcohol as a 24:1 mixed solution, mix well and place it at room temperature for 10-20min, 12000r / min Centrifuge for 10 min, remove the supernatant, wash the precipitate with absolute ethanol and 70% ethanol in turn, add TE...

Embodiment 3

[0062] To check the validity of the DNA chip and the ginseng DNA database, the inspectors do not know the authenticity of the tested ginseng samples:

[0063] 1. Extract the tested ginseng sample by CTAB method, the specific process is as follows: add 4ml CTAB extract and 80ul mercaptoethanol to the centrifuge tube, preheat it in a water bath at 65±5°C, take the ginseng sample, grind it into powder with liquid nitrogen , transferred to a preheated centrifuge tube, sealed, and incubated in a water bath at 65±5°C for 30±10 minutes, took out the centrifuge tube, cooled down to room temperature quickly, and added 4ml of phenol: chloroform: isoamyl alcohol to a ratio of 25: 24:1 mixed solution, mix well to form a mixed emulsion; centrifuge at 12000r / min for 10min, take the supernatant, add 4ml of chloroform: isoamyl alcohol to the mixed solution of 24:1, mix well and place it at room temperature for 10- Centrifuge at 12000r / min for 10min for 20min, remove the supernatant, wash the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the ginseng identification and anti-counterfeiting field, and particularly relates to a ginseng DNA rapid identification Internet-of-Things anti-counterfeiting tracing systemand an anti-counterfeiting tracing method. The rapid identification Internet-of-Things anti-counterfeiting tracing system comprises a cloud, a DNA chip, an identification device, a traceable tag, a DNA retrieval terminal and a tracing retrieval terminal. The ginseng DNA rapid identification Internet-of-Things anti-counterfeiting tracing system adopts the DNA chip and the traceable tag, institutions having the ability to conduct biological detection experiments can perform rapid detection by means of the DNA chip, and authenticate true and false through DNA big data analysis, so as to perform anti-counterfeiting; institutions which do not have the ability to conduct biological detection experiments can trace ginseng by means of the traceable tag, check production, processing, storage, transaction, logistics, terminal and detection information of ginseng, and can analyze whether an anomaly exists in the cloud and send an analysis result to a querier. Through utilizing the big data, the data queried by means of the traceable tag changes with time and space, and abnormal query condition can be discovered by the system even if an identical traceable tag is copied, thereby realizing effectively control of the copying by counterfeiters and forming a better anti-counterfeiting means.

Description

technical field [0001] The invention belongs to the field of ginseng identification and anti-counterfeiting, and in particular relates to an anti-counterfeiting traceability system and an anti-counterfeiting traceability method of the Internet of Things for rapid identification of ginseng DNA. Background technique [0002] Ginseng (Panax ginseng C.A.Mey) is a plant of the genus Panax of the family Araliaceae, and the so-called commercial ginseng usually refers to the dry root of the plant. The active components of ginseng that have been found mainly include ginsenosides, ginseng polysaccharides, volatile oils, amino acids and polypeptides. It has various physiological functions such as improving the body's immunity, anti-aging, promoting learning and memory functions, detoxification, and antibacterial, and has good effects on diseases such as cardiovascular diseases, tumors, inflammation, and peptic ulcers. Ginseng can enhance the body's anti-fatigue function, can also rela...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G06Q30/00C12Q1/6895C12Q1/6837C12Q1/6806
CPCG06Q30/0185C12Q1/6806C12Q1/6837C12Q1/6895
Inventor 怀化
Owner 亳州中药材商品交易中心有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com