Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of a Cucumber Calcium Binding Protein Gene cscam in Improving Heat Tolerance of Plants

A technology of calcium-binding protein and heat resistance, applied in the fields of application, plant peptides, plant products, etc., can solve the problems of not many, poor development of flower organs, weak plant growth, etc., and achieve the effect of improving heat resistance

Active Publication Date: 2020-06-12
SOUTH CHINA AGRI UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

High temperature makes the seedlings grow leggy, the plant growth becomes weak, the flowering period is shortened, the flower organs are stunted, the viability of the pollen is reduced, the pollination and fertilization are not normal, the flowers and fruits are dropped, the cork of the fruit is aggravated or the deformed fruit is formed, and various diseases are infected, which makes the plant prematurely senile , seriously affecting the yield and quality of cucumber
[0004] At present, there are still not many cucumber varieties resistant to high temperature stress above 35°C and related researches, and cucumber varieties with strong heat resistance are still lacking, which cannot meet the needs of production
The research on heat resistance of cucumber mainly focuses on the effects of high temperature heat damage on external morphology and main economic traits of cucumber, heat resistance physiology of cucumber, genetic law of heat resistance and identification method of heat resistance, etc. The innovative aspects of heat-resistant resources are not well studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a Cucumber Calcium Binding Protein Gene cscam in Improving Heat Tolerance of Plants
  • Application of a Cucumber Calcium Binding Protein Gene cscam in Improving Heat Tolerance of Plants
  • Application of a Cucumber Calcium Binding Protein Gene cscam in Improving Heat Tolerance of Plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Acquisition and expression analysis of cucumber calcium-binding protein gene CsCaM

[0045] 1. Gene sequence analysis of cucumber calcium-binding protein gene CsCaM

[0046] (1) Using the genomic DNA of the cucumber inbred line "02-8" as a template, PCR amplification was performed using upstream and downstream primers:

[0047] Upstream primer: ATGGCGGATCAGCTCACCGA;

[0048] Downstream primer: CCTTAGCCATCATGACCTTAAC;

[0049] PCR reaction system: 1 cycle at 94°C for 3min; 94°C for 1min, 55°C for 45s, 72°C for 90s, a total of 35 cycles; 72°C extension for 7min, and the PCR product was stored at 4°C.

[0050] Specific fragments were amplified from the cucumber genome, connected to the expression vector, and transformed into competent Escherichia coli DH5α to obtain positive recombinant bacteria for sequencing.

[0051] (2) After sequencing, the reading frame of the gene is 450bp, as shown in SEQ ID NO: 1, encoding 149 amino acids, as shown in SEQ ID NO: 2. A...

Embodiment 2

[0072] Example 2 Acquisition of overexpression strains of cucumber calcium-binding protein gene CsCaM

[0073] 1. Construction of expression vector

[0074] The positive recombinant bacterium obtained in the above step is used as a template to carry out PCR to amplify the CsCaM gene, and the specific primers used are:

[0075] P1: 5′- CTCTAGA ATGGCGGATCAGCTCACCGA-3′;

[0076] P2: 5′-C GGATCC CCTTAGCCATCATGACCTTAAC-3';

[0077] The underlined part is the restriction site of XbaI and BamHI. The pBI121 vector was double-digested with XbaI and BamHI, electrophoresis, and a large fragment was recovered. The CsCaM gene PCR product was also double-digested with XbaI and BamHI, and the fragment was recovered. Then, the CsCaM fragment was mixed with pBI121 and ligated with T4 ligase. The ligation product was transformed into Escherichia coli, the recombinants were screened, the plasmid pBI-CsCaM was extracted, and the pBI-CsCaM was transformed into Agrobacterium for transforming...

Embodiment 3

[0081] Example 3 Overexpression of CsCaM in cucumber improves heat tolerance of cucumber

[0082] 1. Heat tolerance identification of transgenic plants

[0083] (1) After the transgenic plants were selfed, T1 transformed plants were obtained, and the T1 generation plants of three transgenic lines (OE-1, OE-2, and OE-3) were selected for heat tolerance identification.

[0084] (2) The results showed that after 5 days of high temperature treatment at 43°C, the mortality rate of non-transgenic plants was more than 30%, while the mortality rate of transgenic plants was less than 5%. After 10 days of high temperature treatment, all non-transgenic plants died, while the survival rate of transgenic plants was still over 60% ( Image 6middle A and B); under high temperature treatment, the radicle length of seeds of transgenic plants was longer than that of non-transgenic plants (see Image 6 Middle C), showing that overexpression of CsCaM gene can improve the heat tolerance of cucum...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a cucumber calcium binding protein gene CsCaM in increasing heat resistance of plants. Coded nucleotide sequence of the gene is shown as SEQ ID NO:1, and the amino acid sequence is shown as SEQ ID NO:2. According to the calcium binding protein gene sequence of a plant, primers are designed, the cucumber calcium binding protein gene is cloned from cucumbers, and moreover, the cucumbers are transformed, so that a transgenic plant which overexpresses the cucumber calcium binding protein gene CsCaM is obtained. The heat resistance of the transgenic cucumber plant is increased, and a high heat-resistant cucumber variety is bred.

Description

technical field [0001] The present invention relates to the technical field of improving plant resistance, more specifically, relates to the application of a cucumber calcium-binding protein gene CsCaM in improving plant heat resistance Background technique [0002] Cucumber (cucumis sativus L.) is an important vegetable crop of Cucurbitaceae (cucurbitaceae). It is fed with young and tender fruit. The fruit is crisp, tender and refreshing, with unique flavor. It is rich in carbohydrates, mineral salts and ascorbic acid. Use and other effects, deeply loved by the people. Cucumber has a long history of cultivation and is one of the most widely cultivated vegetables in the world. It can be grown in the open field or in protected areas. my country is the country with the largest cucumber production area and the highest total output in the world. According to statistics from the Ministry of Agriculture, the country The cucumber sowing area is 1.253 million hm 2 about. Cucumbers...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/34
CPCC07K14/415C12N15/8271
Inventor 曹必好余炳伟董日月雷建军陈长明颜爽爽张芝蕊刘开
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com