Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of gold nanoparticle as adjuvant to preparation of virus-like particle (VLP) vaccine

A gold nanoparticle, virus-like technology, applied in vaccines, viruses, antiviral agents, etc., can solve problems such as unsatisfactory duration of immunity and low level of cellular immunity

Active Publication Date: 2017-10-20
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI +1
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, compared with inactivated viruses, virus-like particles have a lower level of cellular immunity, are easily degraded, and the duration of immunity is not ideal, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gold nanoparticle as adjuvant to preparation of virus-like particle (VLP) vaccine
  • Application of gold nanoparticle as adjuvant to preparation of virus-like particle (VLP) vaccine
  • Application of gold nanoparticle as adjuvant to preparation of virus-like particle (VLP) vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] The preparation of embodiment 1O type foot-and-mouth disease virus-like particle vaccines

[0042] 1. Expression and purification of FMD capsid proteins VP0, VP1 and VP3

[0043] (1) Construction of small ubiquitin-like modified protein fusion expression vectors pSMA and pSMK:

[0044] a. Using Saccharomyces cerevisiae genomic DNA as a template, using smt3F and smt3R as primers to amplify the smt3 gene, the primer sequences are as follows:

[0045] smt3F: 5'GCCATGGGTCATCACCATCATCATCATCACGGGTCGGACTCAGAAGTCAATCAA3',

[0046] smt3R: 5'GGATCCGAGACCTTAAGGTCTCCAACCTCCAATCTGTTCGCGGTG3',

[0047] b. After double digestion with NcoI and BamHI, insert the smt3 gene into the pET-28a vector treated with the same endonuclease, the resulting vector is pSMK, and replace the kanamycin resistance gene of pSMK with the ampicillin resistance gene , to obtain vector pSMA;

[0048](2) Construction of recombinant expression vector of foot-and-mouth disease structural protein gene

[004...

Embodiment 2

[0070] Example 2 Cytotoxicity experiment of gold nanoparticles

[0071] at 37°C, 5% CO 2 Hamster kidney cells (BHK) and mouse peritoneal macrophages (RAW264.7) cultured in the incubator for 2 days were digested with trypsin, and after discarding the trypsin, DMEM culture solution containing 10% calf serum was added, lightly Gently pipette the cells up, count the cells, and dilute the cells to 10 6 cells / mL, add to 96-well plate, add 100 μL of cell solution per well, at 37°C, 5% CO 2 Culture in the incubator for 24 hours, set aside the control wells, discard the original culture solution, and add different concentrations (5 μg / mL, 10 μg / mL, 20 μg / mL, 40 μg / mL, 60 μg / mL, 80 μg / mL, 100 μg / mL , 200μg / mL, 400μg / mL) of AuNC and AuNS, each concentration set three replicates, and then placed in 37 ℃, 5% CO 2 They were cultured in the incubator for 24h, 48h and 72h respectively. After the culture was over, 20 μL of MTS was added to each well, placed in the incubator for 4 hours, and...

Embodiment 3

[0072] Example 3 Effect of gold nanoparticles on phagocytosis of macrophages

[0073] Place at 37°C, 5% CO 2 The RAW264.7 cells cultured in the incubator for 2 days were digested with trypsin, the digested cells were discarded with trypsin, and DMEM culture solution containing 10% calf serum was added, the cells were gently blown up, and the cell count was performed. Dilute the cells to 10 6 cells / mL, add to 96-well plate, add 100 μL to each well, at 37°C, 5% CO 2 After culturing in the incubator for 24 hours, PBS, Flagelin, VLPs, AuNC, AuNS, AuNC-VLPs and AuNS-VLPs of different concentrations (5μg / mL, 10μg / mlL, 20μg / mL) were added respectively. at 37°C, 5% CO 2 Incubate in an incubator for 24 hours, add 200 μL of 0.072% neutral red solution to each well, remove the neutral red solution after 30 minutes of incubation, wash with PBS three times, add cell lysate (a mixture of equal volumes of 0.01M glacial acetic acid and absolute ethanol ) 200 μL. After the cells were lysed...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention discloses application of a gold nanoparticle as an adjuvant to preparation of a VLP vaccine. According to the invention, the gold nanoparticle is used as the adjuvant for preparation of the VLP vaccine, and the gold nanoparticle is a gold nanocage or gold nanostar, preferably; results show that a conjugation product of the gold nanoparticle and VLPs can release carried VLPs after entering an animal body via injection and thus induce specific antibody immune response and T-lymphocyte immune response; and thus, it is proved that the gold nanoparticle is applicable as the adjuvant of VLPs for effective stimulation of specific immune response in animal bodies. The gold nanoparticle provided by the invention is applied as the adjuvant capable of improving the immune effect of VLPs against foot and mouth disease viruses and better promoting generation of cellular immunity and humoral immunity of VLP vaccines for preparation of the VLP vaccine.

Description

technical field [0001] The invention relates to a new application of gold nanoparticles, in particular to the application of gold nanoparticles in the preparation of virus-like particle vaccine adjuvants, and the invention belongs to the technical field of veterinary drug research. Background technique [0002] Virus like particles (VLPs) are nanoscale particles that are self-assembled by viral capsid proteins and have the same shape as intact virions. Because they do not contain the viral genome and have no replication ability, they are not infectious. VLPs vaccine has the advantages of high safety, simple preparation method and low cost, making it a hot spot in the field of international vaccine research, and has made progress in various infectious diseases and anti-tumor aspects of humans and animals. VLPs vaccines that have been commercialized include hepatitis B vaccine, human papilloma vaccine and hepatitis E vaccine. However, compared with inactivated viruses, virus-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/39A61K39/135A61P31/14
CPCA61K39/12A61K39/39A61K2039/5258A61K2039/552A61K2039/55505C12N2770/32134
Inventor 郭慧琛孙世琪张智军滕志东黄洁陈浩徐小雨茹嘉喜常艳燕冯霞刘湘涛殷宏
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com