Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Cephalosporin C acylase mutant with higher heat stability and construction method thereof

A cephalosporin and thermal stability technology, applied in the field of biological genetic engineering, can solve the problems of reduced catalytic efficiency, CPC enzyme inactivation, poor stability, etc., achieve good reaction temperature, good thermal stability, and ensure production catalysis efficiency effect

Active Publication Date: 2017-05-17
WUHAN HANHAI NEW ENZYMES BIOLOGICAL TECH CO LTD
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, CPC acylase still has some problems such as heat sensitivity and poor stability in application (Applied and environmental microbiology, 1996, 62 (8): 2919-2925; World Journal of Microbiology and Biotechnology, 2011, 27( 4):823-829), the optimal temperature of SE83acyII S12 is only 40°C, and the heat generated during the production process will easily inactivate the CPC enzyme, resulting in a decrease in catalytic efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cephalosporin C acylase mutant with higher heat stability and construction method thereof
  • Cephalosporin C acylase mutant with higher heat stability and construction method thereof
  • Cephalosporin C acylase mutant with higher heat stability and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Cloning of embodiment 1 wild-type cephalosporin C acylase gene

[0041] The cephalosporin C acylase gene derived from Pseudomonas sp.SE83 was codon-optimized with Escherichia coli as the host, and the sequences of the upstream and downstream primers were designed as follows:

[0042] Upstream primer F: 5'-ATAT CATATG ACGATGGCGGCCAAGACCGATCGCGAGGCCCTGCAGGCGGCGCTGCCGCCGCTTTCCGGCAGCCTCTCCATTCCGGGTTTAAGCGCCCCTG-3'

[0043] Downstream primer R: 5'-ATAT CTCGAG TTAGGCCGGAACCAGCTCCTGGCTG-3'

[0044] Wherein the underlines are NdeI and XhoI restriction sites respectively. PCR reaction system: 25 μL of 2×PrimeStar Max DNA polymerase, 1.0 μL of upstream and downstream primers (10 μmol / L), 1.0 μL of gene template (50 ng / μL), and 22 μL of double distilled water. The PCR reaction conditions were: 98°C for 2min, then 98°C for 10sec, 55°C for 15sec, 72°C for 30sec, a total of 25 cycles; and finally 72°C for 10min. After the reaction, the PCR amplification product was detected by...

Embodiment 2

[0045] Example 2 Expression and purification of wild-type cephalosporin C acylase

[0046] The engineered bacteria were inoculated into 4 mL LB medium test tubes containing 100 μg / mL Kan at a volume ratio of 1%, and cultured at 37°C and 220 rpm for 12 hours. Transfer the 4mL bacterial liquid to a 1L LB medium shake flask containing 50μg / mL Kan, culture at 37°C 220rpm for about 2.5h, make the OD600 reach about 0.9, add 0.5mM IPTG inducer, and induce culture at 25°C 220rpm for 12- 16h. The Escherichia coli cell suspension harvested after fermentation is ultrasonically disrupted, and then subjected to Ni-NTA affinity chromatography to obtain the target protein with a purity of more than 95%.

Embodiment 3

[0047] Example 3 Homologous modeling of wild-type cephalosporin C acylase

[0048] Since the crystal structure of wild-type cephalosporin C acylase SE83acyII S12 has not yet been resolved, it is difficult to operate through conventional protein rational design methods, so we provide a homology model using N176acy with high homology (PDB ID: 4HSR) as a template Methods.

[0049] 1) Enter the homepage of the SWISS-MODEL database (https: / / www.swissmodel.expasy.org / ), enter the amino acid sequence of cephalosporin C acylase SE83acyII S12 in the Target Sequence tool to search. The server directly searches for the sequence with the highest homology 4HSR as a template for sequence comparison, and obtains the structure model of the target protein.

[0050] 2) Search for the structure of cephalosporin C acylase (N176acy, PDB ID: 4HSR) with the highest homology to cephalosporin C acylase SE83acyII S12 derived from Pseudomonas diminutaN176 in the Protein Data Bank (PDB database), The s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cephalosporin C acylase mutant with higher heat stability. A mutation site of the cephalosporin C acylase mutant is selected from any one of No.113 locus glutamic acid, No.218 locus arginine, No.226 locus lysine, No. 334 locus glutamic acid, No.454 locus glutamic acid, No.547 locus glycine and No.632 locus tryptophan of an amino acid sequence shown as SEQ ID NO: 1. The invention also provides a construction method for the mutant. A mutation hotspot is selected on the basis of the analysis for a high B factor locus on the enzymatic structure. Target protein is selected after a genetic engineering method is adopted for introducing fixed locus saturated mutation. The invention has the advantages and beneficial effects that the mutant with the half-life period obviously longer than that of the wild cephalosporin C acylase is acquired, the industrial production can be more effectively adapted, the source for acquiring the cephalosporin C acylase mutant can be expanded according to a homological modeling method provided by the invention and the probability of selecting the mutant meeting the requirement can be increased.

Description

technical field [0001] The invention relates to biogenetic engineering technology, in particular to a cephalosporin C acylase mutant with improved thermal stability and a construction method thereof. Background technique [0002] Cephalosporins antibiotics are the second type of broad-spectrum antibiotics used in clinical treatment after penicillin, accounting for about 40% of the global antibiotic market (Turkish Journal of Biochemistry, 2014,39(1):51-56) . 7-Aminocephalosporanic acid (7-ACA), as a key intermediate of many semi-synthetic cephalosporin antibiotics, is of great value in the pharmaceutical industry. Currently, 7-ACA is mainly synthesized by chemical or enzymatic methods from Cephalosporin C (CPC). Compared with the chemical method, the enzymatic method has the advantages of simple process, safety, high efficiency, and less pollution, so it has been paid more and more attention by people. [0003] 7-ACA enzymatic production is mainly divided into two-step en...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/80C12N15/70
CPCC12N9/80C12Y305/01093
Inventor 谢渊刘新花杨广宇刘天罡马富强
Owner WUHAN HANHAI NEW ENZYMES BIOLOGICAL TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com