Marked vaccine strain of genotype ⅶ Newcastle disease virus and its application
A technology for Newcastle disease virus and vaccine strains, applied in the direction of antiviral agents, virus/phage, virus antigen components, etc., to achieve the effect of genetic stability and good immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1M
[0043] Example 1 MG7-NPΔ18 and MG7-NP mut3 strain rescue
[0044] 1. Experimental method
[0045] 1.1G7 strain genome full-length cDNA construction
[0046] Using the Trizol method to extract the genomic RNA in the allantoic fluid inoculated with chicken embryos of the G7 strain, the detailed steps are as follows:
[0047] ① Take 250 μL of chicken embryo allantoic fluid, add 750 μL Trizol (Invitrogen, USA), shake and mix well, and let stand at room temperature for 5 minutes;
[0048] ② Add 200 μL of chloroform to each tube, cap the centrifuge tube tightly, shake the centrifuge tube vigorously for 15 seconds; place at room temperature for 10 minutes, and centrifuge at 12000 rpm for 15 minutes;
[0049] ③ Take the upper aqueous phase and place it in a new centrifuge tube, add 700 μL of isopropanol, place at 4°C for 10 minutes, and centrifuge at 12,000 rpm for 10 minutes;
[0050] ④ Discard the supernatant, add 1mL 75% ethanol, mix well, and centrifuge at 8500g for 5 minutes ...
Embodiment 2
[0087] Example 2 MG7-NPΔ18+F mut Rescue of labeled vaccine strains
[0088] 1. Experimental method
[0089] 1.1 Mutation of cleavage site of F protein of MG7-NPΔ18 strain and construction of full-length cDNA
[0090] MG7-NPΔ18 and MG7-NP rescued by Example 1 of the present invention mut3 Strain virus virulence is not obviously weakened, therefore, on the basis of the plasmid pMG7-NPΔ18 constructed in Example 1, the present invention mutates the F protein cleavage site, and the F protein cleavage site RRQKRF is mutated to GRQGRL, GRQKRF, RRQGRF respectively and RRQKRL, to obtain the mutant plasmid pMG7-NPΔ18+F mut , pMG7-NPΔ18+F mut-1 , pMG7-NPΔ18+F mut-2 and pMG7-NPΔ18+F mut-3 .
[0091] Primers used to mutate the F protein cleavage site are as follows:
[0092] F7: 5'CTCCGACCAAAACCCCCCACACTCCCTG3';
[0093] R7:5'AGAGTAGAGAAGAATACCCTCCCTGTTGCAG3';
[0094] F8: 5'TCTGTGTCCACGTCTGGAGGAGGGAGACAGGGGCGCCTTATAGGTGCTGTTATTGGCAG3';
[0095] R8: 5'CTGCCAATAACAGCACCTATAAGGCGC...
Embodiment 3
[0127] Example 3 MG7-NPΔ18+F mut Experiment of immune effect of labeled vaccine strains on SPF chickens
[0128] 1. Experimental method
[0129] In order to measure the MG7-NPΔ18+F rescued by Example 2 of the present invention mut Marked vaccine strain (microorganism preservation number is: CCTCC NO: V201505; for the immune protection of 4-week-old SPF chickens, use 9-day-old SPF chicken embryos to amplify the virus, collect allantoic fluid, and measure the EID of the marked vaccine strain 50 5.62×10 9 / mL, when preparing a vaccine, the virus was diluted to 3.16×10 9 / mL.
[0130] The virus is inactivated after dilution. The specific operation is: first dilute the analytically pure formaldehyde (no crystal) solution with sterilized physiological saline at 1:10, then add the diluted formaldehyde solution to the virus solution, and shake it while adding it. The final concentration of formaldehyde solution is 0.15% (for example, add 1 mL of formaldehyde solution diluted 1:10...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com