Applications of human SAMD9L gene and protein product encoded by human SAMD9L gene
A gene and protein technology is applied to the application of the human SAMD9L gene and its encoded protein product in the diagnosis and treatment of liver cancer, which can solve the problem of no public report of the SAMD9L protein, and achieve the effect of accurate diagnosis and control of proliferation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 110
[0043] Example 1 Exome capture sequencing of 10 liver cancer patients
[0044] 1. A total of 29 tissue samples from 10 patients with liver cancer in Guilin, Guangxi, my country (10 paracancerous tissues, 10 cancerous tissues, and 9 portal vein tumor thrombus tissues, of which DNA in one patient’s liver portal vein tumor thrombus tissue was severely degraded) were organized DNA extraction.
[0045] The tissue DNA extraction kit from QIAGEN, Germany was used, and the experimental steps were carried out according to the product instructions. The extracted DNA passed the quality inspection by ND-1000 spectrophotometer and 0.8% agarose gel electrophoresis before it was ready for use. One patient's portal vein tumor thrombus tissue DNA was degraded, and the DNA quality of the remaining 29 tissue samples met the requirements.
[0046] 2. Nimblegen exon capture, the genomic DNA is first randomly broken into fragments of about 500bp, and then adapters are connected to both ends of the...
Embodiment 2
[0053] The Sanger method sequencing of embodiment 2 PCR products
[0054] 1. PCR amplifies a specific DNA fragment in the coding region of the SAMD9L gene, and the primer sequence is as follows ("F" stands for forward primer, "R" stands for reverse primer):
[0055] P55-F: GATCTGCCGTTGCAGAAAAT (SEQ ID NO: 1),
[0056] P55-R: TGGTTTGCTGTGTTGGAGTT (SEQ ID NO: 2);
[0057] P929-F: GGCCTTCAATGGAAAATCCT (SEQ ID NO: 3),
[0058] P929-R: AGACCTCCTGCGTCGTCTAA (SEQ ID NO: 4);
[0059]Using high-fidelity hot-start DNA polymerase Hotstar Taq, the PCR reaction system is as follows: forward primer, reverse primer, 10×PCR buffer, MgCl 2 , dNTP, Hotstar Taq DNA polymerase (QIAGEN Company), DNA template (sample in Example 1), the volumes of each component are 0.5, 0.5, 5, 1, 0.5, 0.1, 1 μl, and finally add sterile deionized Water made the reaction volume 50 μl.
[0060] The reaction conditions for PCR were deformation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds...
Embodiment 3
[0063] Example 3 Sequencing analysis of SAMD9L gene coding sequence in 80 liver cancer patient tissues by Sanger method
[0064] 1. The tissue samples of 80 cases of liver cancer patients were obtained from the surgically excised cancer tissue and paracancerous tissue samples of liver cancer patients in hospitals in Guilin, Guangxi, Wuxi, Jiangsu, and Suzhou, Jiangsu. All tissue samples were frozen and stored at -80°C. The human tissue manipulations involved were approved by the Ethics Committee of the National Human Genome Southern Research Center.
[0065] 2. The tissue DNA extraction kit from QIAGEN, Germany was used, and the experimental steps were carried out according to the product instructions.
[0066] 3. The coding sequence of the SAMD9L gene is located on the fifth exon of the gene, and the coding nucleic acid sequence (CCDS34681.1) comes from the NCBI nucleic acid sequence database (http: / / www.ncbi.nlm.nih.gov / ), according to SAMD9L Primers were designed for the c...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com