Leifsonia xyli HSO904-based short chain dehydrogenase, and encoding gene, carrier, engineering bacteria and application thereof
A technology of short-chain dehydrogenase and Reflutonella, which is applied in the field of short-chain dehydrogenase, can solve the problems of low activity of short-chain dehydrogenase/reductase, limitation of large-scale preparation and application, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Embodiment 1: Derived from short-chain dehydrogenase, coding gene of Reflussonella
[0058] The total genomic DNA of the Leifsonia xyli HS0904 strain was extracted with a nucleic acid extraction kit (Axygen Co.) (this strain has been protected as a new strain in the Chinese invention patent ZL201010523043.X and preserved in the Chinese Typical Culture Collection Center, address: China, Wuhan, Wuhan University, collection number is CCTCC M2010241, storage date: September 21, 2010), using the genomic DNA as a template, primer 1 (ATGGCNCARTAYGAYGTNGC), primer 2 (YYAYTGNGCNGTRTAKCCYCC) under the effect of PCR amplification.
[0059] Addition amount of each component of the PCR reaction system (total volume 50 μL): Pfu DNA Polymerase mix 25 μL, cloning primer 1 and primer 2 each 3 μL (100 μM), genomic DNA 1 μL, nucleic acid-free water 18 μL. Biorad PCR instrument was used to amplify. The PCR reaction conditions were: pre-denaturation at 95°C for 5min, followed by temperatur...
Embodiment 2
[0060] Embodiment 2: Vector and recombinant genetically engineered bacteria
[0061] According to the analysis results of Example 1, expression primers 3 and 4 were designed, and Nco I and Hind III restriction enzyme sites were introduced into primers 3 and 4, respectively. In primer 3 ( CCATGG CGCAGTACGACGTGG, the underlined part is the Nco I restriction site, the italic part is the protected base) and primer 4 ( AAGCTT CTATTGTGCTGTGTAGCCTC, the underlined part is the Hind III restriction site, and the italic part is the protective base), and the high-fidelity Pyrobest DNA polymerase was used to amplify to obtain a 756bp short-chain dehydrogenase gene fragment (SEQ ID NO .1), after sequencing, use Nco I and Hind III restriction endonuclease to treat the amplified fragment, and use T4DNA ligase to treat the amplified fragment with the expression vector pET28a(+) treated with the same restriction endonuclease Connection, construction of expression vector pET28a(+)-SDR, p...
Embodiment 3
[0063] The recombinant Escherichia coli BL21 / pET28a(+)-SDR containing the expression recombinant plasmid pET28a(+)-SDR verified in Example 2 was used at 37°C and 200rpm in LB liquid medium containing 50 μg / mL kanamycin Shake culture for 12 hours, then inoculate into fresh LB liquid medium containing 50 μg / mL kanamycin with a volume concentration of 1% inoculum, and culture at 37°C and 200 rpm to the cell concentration OD 600 0.6-0.9, then add isopropyl-B-D-thiogalactopyranoside (IPTG) with a final concentration of 0.1mM to the culture medium, place at 30°C, 200rpm for 10h, centrifuge at 4°C, 10000rpm for 10min , collect the cells, wash the cells twice with normal saline, and collect the wet cells (that is, the whole cells of the recombinant bacteria).
[0064] (R)-3,5-bistrifluoromethylphenethanol is prepared by using wet bacteria as the enzyme source for transformation and using 3,5-bistrifluoromethylacetophenone as the substrate for the transformation reaction. Transformati...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap