Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Enzyme-linked immunosorbent assay vector and kit for detecting avian leukosis P27

An enzyme-linked immune reagent and enzyme-linked immune reaction technology are applied in the field of serological diagnosis of animal diseases, which can solve the problems of no avian leukemia antigen enzyme-linked immune detection kit, poor sensitivity, false positives, etc. The effect of low cost and easy operation

Active Publication Date: 2013-08-21
LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS +2
View PDF6 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The earliest method that can be used for clinical detection is the Joan expansion test, but its sensitivity is poor, and there are certain false positives. Therefore, people turn their attention to the more sensitive, specific, and easy-to-operate ELISA detection method
However, so far there is still no ELISA kit that can simultaneously detect all subgroups of avian leukosis antigens and has high efficiency, sensitivity and specificity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Enzyme-linked immunosorbent assay vector and kit for detecting avian leukosis P27
  • Enzyme-linked immunosorbent assay vector and kit for detecting avian leukosis P27
  • Enzyme-linked immunosorbent assay vector and kit for detecting avian leukosis P27

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0082] Preparation of LB liquid medium: Add 5g of yeast extract, 10g of peptone and 10g of NaCl into the container; add distilled water to 1000ml, adjust the pH to 7.0-7.2 with NaOH and HCl, and pack and sterilize.

[0083] instrument

[0084] Table 1 Instrument source and model

[0085]

[0086]

Embodiment 1

[0087] Embodiment 1. Preparation of the recombinant plasmid of the avian leukosis virus P27 gene

[0088] According to the nucleotide sequence of RSV P27 gene included in GenBank (the sequence is 1381agactggctg atacggtcaggaccaagggc ttacgatccc cgatcactat ggcggaggtg

[0089] 1441 gaagcgctta tgtcctcccc gctgctgccg catgacgtta cgaatctaat gagagttatt

[0090] 1501 ttaggacctg ccccatatgc cttgtggatg gacgcttggg gtgtccaact acagacggtt

[0091] 1561 atagcggcag ccactcgcga cccccgacac ccagcgaatg gtcaagggcg gggggaacgg

[0092] 1621 actaatttgg atcgcttaaa gggtttagct gatgggatgg tgggcaaccc gcagggtcag

[0093] 1681 gccgcattat taagaccggg ggaattggtt gctattacgg cgtcggctct ccaggcattt

[0094] 1741 agagaggttg cccggctggc ggaacctgct ggtccatggg cggacattac gcagggacca

[0095] 1801 tctgagtcct ttgttgattt tgccaatcgg cttataaagg cggttgaggg gtcagatctc

[0096] 1861 ccgccttccg cgcgagctcc ggtgatcatt gactgcttta ggcagaagtc acagccagat

[0097]1921 atccagcagc ttatacgggc agcaccctcc acgctgacca ccccaggaga gataatcaaa ...

Embodiment 2

[0100] Example 2. Expression of Avian Leukosis Virus P27 Protein

[0101] Induced expression of avian leukosis P27 gene in Escherichia coli: transform the recombinant plasmid into Escherichia coli BL21, inoculate it in LB solid medium containing ampicillin (Amp) resistance, culture overnight at 37°C, and take 3~ 4 single colonies were inoculated in LB liquid medium containing Amp, cultured to OD at 37°C with shaking (250rpm) 600 =0.6, add IPTG (isopropyl-β-D-thiogalactopyranoside) to a final concentration of 1mmol / l, and continue to culture at 37°C for 3 hours to obtain the expressed protein, the expression of avian leukemia P27 protein is 565mg / L. At the same time, an uninduced negative control was cultured. The expressed protein was identified by SDS-PAGE and Western-blot, and the results were as follows figure 1 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of animal epidemic disease serological diagnosis, and relates to an enzyme-linked immunosorbent assay vector and a kit for detecting avian leukosis P27. The avian leukemia virus (P27) enzyme linked immunosorbent assay kit comprises a 96 hole elisa plate coating a avian leukosis P27 polyclonal antibody, P27 monoclonal antibody marked by alkaline phosphatase, a substrate solution, a stop solution and a cleaning solution. The vian leukosis P27 polyclonal antibody and the P27 monoclonal antibody marked by alkaline phosphatase effectively improve the sensitivity, the specificity and the stability of the detection. The invention provides an efficient and sensitive ELISA (enzyme linked immunosorbent assay) detection kit for sifting out and purifying avian leukosis positive chickens and cultivating new species with heredity resistance, and the kit is low in cost and simple and convenient to operate, and is applicable to promotion in animal husbandry.

Description

technical field [0001] The invention belongs to the technical field of serological diagnosis of animal epidemic diseases, and relates to an ELISA carrier and a kit for detecting avian leukemia P27. technical background [0002] Avian Leukosis (AL) is a general term for a variety of tumor diseases in poultry caused by Avian Leukosis Virus (ALV) belonging to the genus Alpharetrovirus in the Retroviridae family. Avian leukosis virus has been classified into 10 subgroups, named A subgroup to J subgroup respectively. Subgroups A to D are exogenous ALV, and subgroup E is endogenous ALV; subgroups A and B were once considered to be the most common exogenous virus subgroups in commercial layer chickens (especially Laihang chickens) , subgroup C and D infection reports are extremely rare, while subgroup E virus includes the extremely common low pathogenic endogenous leukemia virus; subgroup F is isolated from ring-necked pheasant, and subgroup G is isolated from golden yellow Pheas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/577G01N33/68
Inventor 吴培星宋楠遇秀玲李纯玲宁海强韩涛张继瑜
Owner LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com