Monoclonal antibody for resisting cell surface ectopic expression, and preparation method and application thereof
A monoclonal antibody, cell surface technology, applied in the direction of antibodies, fusion cells, chemical instruments and methods, etc., can solve problems such as elevation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Four gastric cancer cell lines mixed in equal proportions (BGC823, MKN28, MKN45 and SGC7901, all from Shanghai Institute of Cell Biology, Chinese Academy of Sciences) were cultured in RPMI1640 medium containing 10% FBS, 5% CO 2 , After culturing at 37°C, the collected mixed living cells were used as immunogens in PBS buffer, in A / J-JAX mice (purchased from the Experimental Animal Model Center of Nanjing University, and the mice were from The Jackson Laboratory, the United States) Immunized by subcutaneous and intraperitoneal injection on the back, 1×10 per mouse each time 7 1 cell, immunized once every other week; one week after the third immunization, the mouse serum was collected, and the flow cytometry high-throughput system (FACS-HTS) was used to detect the reaction between the serum and 4 gastric cancer cell lines, and the PBMC of healthy volunteers As a control cell [Peripheral Blood Mononuclear Cells (PBMC) were separated from the peripheral blood of healthy volu...
Embodiment 2
[0049] Total RNA was extracted from the MS17-57 monoclonal antibody hybridoma cell line with the RNeasy kit from Qiagen (Valencia, California, USA), and the mRNA was reversed with the SuperScript III First-Strand kit from Invitrogen (Grand Island, New York, USA) The cDNA library of MS17-57 monoclonal antibody was recorded. Using the 23 primers of the "Mouse IgG Library Primer Set" (F2010) kit from ProgenBiotechnik in Germany, 21 PCR reactions (reactions not including the lambda light chain) were performed, and the specific light and heavy chain products generated were subjected to DNA sequencing and amino acid analysis. Translation of polypeptide sequences and identification of CDRs (epitope regions) and FWs (framework regions).
[0050]Table-1(a), the cDNA sequence of the variable region of the MS17-57 monoclonal antibody light chain (SEQ ID NO: 1):
[0051] 5'-atgtctgcatctccagggggaaaaggtcaccatgacctgcagggccagctcaagtat
[0052] aatttccagttacttgcactggttccagcagaagtcaggtgcccccc...
Embodiment 3
[0074] On a 96-well "U"-shaped plate, use 1% BSA / PBS to prepare an average of about 200,000 different gastric cancer cells / 100 microliters per well and add it to the U-shaped plate, and multiply the serum after immunization of living gastric cancer cells by 5 times. The titer was serially diluted, and then 100 μl was added to each well, mixed well and reacted on ice or at 4°C for 20 minutes, after washing twice, add 100 μL / well of goat anti-mouse IgG Fc-FITC diluted 1:333, 4°C After C reaction and washing, read the MFI value of each well on the LSR-II fluorescence flow cytometer-HTS machine of BD Company.
[0075] The results showed that the titer of the No. 1 mouse serum with high immunoreactivity combined with gastric cancer cells was significantly higher than that of normal human PBMC, and the splenocytes of this mouse were used for the production of MS17-57 monoclonal antibody hybridoma. fusion experiment. (Such as figure 1 shown).
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com