Novel mycobacterium tuberculosis specific fusion protein as well as preparation and application thereof
A technology of Mycobacterium tuberculosis and fusion protein, applied in biochemical equipment and methods, hybrid peptides, specific peptides, etc., can solve the problems of low sensitivity and specificity, not exceeding 70%, and achieve high sensitivity, Effect of low cost, high antigen detection sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0032] The preparation method of the above-mentioned fusion protein Rv0057-Rv1352 comprises:
[0033] (1) Design of the fusion of two protein epitopes: After analyzing the gene sequence and protein structure of Mycobacterium tuberculosis Rv0057 and Rv1352, determine the fusion region, combination and sequence of the two protein epitopes; The antigenic epitopes are connected to form a fusion protein; the antigenic epitope of the Rv0057 protein is located at the amino terminal of the fusion protein, and the antigenic epitope of the Rv1352 protein is located at the shuttle base of the fusion protein. It consists of the key epitopes of two protein antigens, Rv0057 and Rv1352, connected sequentially, called Rv0057-Rv1352;
[0034] (2) Cloning of fusion of two proteins: Cloning by genetic engineering technology.
[0035] ①Add the Nhe I restriction site to the upstream primer of Rv0057, add the DNA sequence encoding 3 hydrophobic amino acids and Spe I and Xho I restriction sites to ...
Embodiment 1
[0039] 1. Cloning the Rv0057 antigen epitope coding gene by genetic engineering technology:
[0040] 1. Design and synthesize a pair of primers for amplifying the Rv0057 epitope according to the sequence 1 in the sequence listing
[0041] Upstream primer (5' end contains restriction endonuclease Nhe I)
[0042] 5'-CTAGCTAGCGTGGTGACCGCGGTCGG-3'
[0043] Downstream primer (contains restriction endonucleases Xho I and Spe I at the 5' end)
[0044] 5'-
[0045] CCGCTCGAGTTATTATTAACTAGTACCGCCACCGGTCATCAACGACCGCCA-3'
[0046] Amplified fragment: 555bp
[0047] 2. Rv0057 gene synthesis
[0048] According to the above design, the PCR product of Rv0057555bp was synthesized by gene, and the synthesized gene fragment was identified by 1.2% agarose gel electrophoresis. figure 1 It is the agarose electrophoresis image of the Rv0057 DNA fragment synthesized by the gene. The sequencing results prove that the DNA band indicated by the arrow in the figure is the position of the PCR produ...
Embodiment 2
[0188] The Rv0057-Rv1352 fusion protein constructed and purified in Example 1 of the present invention was applied to the serological diagnosis of tuberculosis. It is used as the diagnostic antigen of chemiluminescence immunoassay and applied to the test of clinical specimens, and a good diagnostic effect is obtained. Compared with the three currently commercialized tuberculosis antibody detection kits, it significantly improves the sensitivity of tuberculosis diagnosis. The ELISA detection procedure is as follows:
[0189] 1. Experimental specimens: A total of 103 serum specimens were selected and divided into two groups:
[0190] (1) Tuberculosis group: 54 patients with active tuberculosis diagnosed clinically by imaging, laboratory examination and anti-tuberculosis treatment, including 35 males and 19 females, with an average age of 43.1±18.8 years. Including tuberculosis, tuberculous pleurisy, tuberculous pericarditis, tuberculous meningitis, urinary tuberculosis, etc. ...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com