Recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof
A recombinant lentivirus, RNA interference technology, applied in the field of molecular biology, can solve the problems of easy to cause immune response, non-integration of chromosomes, inability to achieve long-term expression, etc., to achieve the effect of convenient transfection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Example 1: Construction of lentiviral vector for gene hNINL
[0060] 1. Design and synthesis of oligonucleotides
[0061] Using Invitrogen's online RNAi series design software BLOCK-iTRNAiDesigner, design 4 interference target sequences for hNINL gene mRNA sequence (NM_025176.4) (see the table below), and synthesize the corresponding double-stranded DNA (Shanghai Sangon Bioengineering Technology Co., Ltd. Services Ltd). The loop structure in the LV3-shRNA template uses TTCAAGAGA to avoid the formation of termination signals. GATCC was added to the 5' end of the sense strand template, which was complementary to the sticky end formed after digestion with BamHI; AATTC was added to the 5' end of the antisense strand template, which was complementary to the sticky end formed after EcoRI digestion.
[0062] serial code
sequence name
target sequence
N351
hNINL-homo-284
TGTGGCTGTGTTGTCTTCATT
N352
hNINL-homo-810
GATCAAGACGGAGA...
Embodiment 2
[0106] Example 2: Encapsulation of hNINL gene RNA interference recombinant lentivirus
[0107] Take the recombinant virus plasmid pGCSIL-sh-hNINL (20 μg) prepared by high-purity endotoxin-free extraction, helper plasmids pHelper 1.0 (15 μg) and pHelper 2.0 (10 μg), and co-transfect 293T cells according to the instructions of Invitrogen Lipofectamine 2000 .
[0108] 8 hours after transfection, replace with complete medium, at 37°C, 5% CO 2 After continuing to culture in the incubator for 48 hours, the cell supernatant rich in lentiviral particles was collected. Centrifuge at 4000g for 10 minutes at 4°C to remove cell debris and filter the supernatant with a 0.45 μM filter to obtain lentivirus for use, which can meet general cell experiments. If you want to obtain a higher concentration of lentivirus, you can further concentrate and purify it to obtain a high-titer lentivirus concentrate. Pack the virus concentrate and store it at -80°C for a long time. Take one of them and fo...
Embodiment 3
[0118] Example 3: Target cell invasion test and gene expression inhibition effect analysis
[0119] 1. Target cell invasion test
[0120] Human breast cancer cell MCF-7 (purchased from the Cell Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) was subjected to virus infection experiment according to the following steps:
[0121] 1) When MCF-7 cells are cultured to 80-90% confluence in a 10 cm culture dish, the culture medium is poured off, and the cells are washed twice with 3 ml of D-Hank's solution.
[0122] 2) Add 1ml of Trypsin-EDTA solution (0.05%, Gibco), mix well, carefully suck off the trypsin solution, and place it at 37°C for 3-5 minutes.
[0123] 3) Add 2ml of DMEM culture medium and pipette to make the cells form a single-cell suspension.
[0124] 4) Count on a blood cell counting board, according to 10×10 5 Inoculate a 6-well plate at the concentration of cells / well and mix well at 37°C 5% CO 2 Incubate for 24 hours.
...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com