Intestinal trefoil factor recombinant expression vector and preparation method of intestinal trefoil factor
A technology of intestinal trefoil factor and expression vector, which is applied in the fields of biotechnology and engineering, can solve the problems of cumbersome purification methods, unstable plasmids, and high costs, and achieve the goals of avoiding methanol pollution and fire hazards, simple fermentation methods, and good biological activity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Construction of recombinant expression vector
[0039] The intestinal trefoil factor gene sequence amplified by RT-PCR was double digested with EcoRI and NotI, then ligated with the yeast secretion expression vector pGAPZɑA treated with the same restriction enzymes, and transformed into Escherichia coli Top10, Recombinant plasmids were screened on low-salt LB plates with a concentration of 20-30 μg / ml Zeocin, and recombinant E. coli Top10 containing recombinant yeast expression plasmid pGAPZɑA-ITF was obtained. See the steps for details figure 1 ,details as follows:
[0040]1. The intestinal trefoil factor gene sequence amplified by RT-PCR, according to the hITF mRNA sequence (Accession No NM003226) retrieved in GeneBank, using the mature peptide cDNA coding region (180bp) of hITF as a template, using Primer 5.0 software Design the following primers, hITF upstream primer: 5′-gaga gaattc caccaccaccaccaccacgaggagtacgtgggcctgtc -3′; hITF downstream primer: 5′...
Embodiment 2
[0066] The preparation of embodiment 2 engineering bacteria
[0067] The recombinant yeast expression plasmid was extracted from the recombinant Escherichia coli Top10 obtained in Example 1, transformed into yeast GS115 after linearization by single enzyme digestion, and positive transformants were screened with zeocinYPD plate at a concentration of 100 μg / mL.
[0068] 1. Preparation of GS115 Competent Yeast
[0069] 1) Inoculate GS115 yeast into 50ml YPD medium, shake the bacteria overnight at 30°C (about 24-28h) and cultivate until the OD value is 0.8-1.0 (about 10 8 Cells / ml);
[0070] 2) Harvest the yeast, wash once with 25ml sterile water, and centrifuge at 1500g for 10 minutes at room temperature;
[0071] 3) Resuspend the yeast in 1mL of 100mM lithium chloride solution, and transfer the suspension to a 1.5ml centrifuge tube;
[0072] 4) Centrifuge at the maximum speed of the centrifuge for 15 seconds to precipitate the bacteria, and resuspend the bacteria in 400 μL ...
Embodiment 3
[0120] Example 3 Using engineering bacteria to prepare intestinal trefoil factor
[0121] 1. Fermentation
[0122] Inoculate the prepared seed medium into the 10L fermentation medium of a 30L fermenter, use a wide range of inorganic salt medium as the fermentation medium, use glucose as the carbon source, no methanol induction and staged fermentation, continuous fermentation for 2 days . Specific steps are as follows:
[0123] 1) Strains: the engineered bacteria obtained in Example 2, that is, the recombinant Pichia pastoris pGAPZɑA-ITF-GS115 strain.
[0124] 2) Medium
[0125] Seed medium:
[0126] Peptone 20g, D-glucose 20g, yeast extract 10g, dilute to 1L.
[0127] Fermentation Basal Salt Medium BSM: 85% H 3 PO 4 26.7ml / L, CaSO 4 2H 2 O 0.93g / L, K 2 SO 4 18.2g / L, MgSO 4 2H 2 O 14.9g / L, KOH 4.13g / L, glycerin 40g / L, PTM1 4.0ml / L
[0128] Among them: PTM1 trace element medium:
[0129] CuSO 4 ·5H 2 O 6.0g / L, KI 0.088g / L, MnSO 4 ·H 2 O 3.0g / L, Na 2 MoO 4 2...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com