Supercharge Your Innovation With Domain-Expert AI Agents!

Application of rice phosphate transport protein gene ORYsa;Pht1;4

A technology for transporting proteins and phosphates, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as environmental pollution, inability to meet plant phosphorus and other problems, and achieve the effect of high phosphorus utilization efficiency

Inactive Publication Date: 2011-07-06
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, on the one hand, the concentration of available phosphorus in the soil is only 1-10 μM, coupled with the limitation of the absorption and utilization efficiency of available phosphorus by plants, it is far from meeting the needs of plant growth and development for phosphorus; on the other hand, the extensive use of phosphorus fertilizers has caused serious environmental pollution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice phosphate transport protein gene ORYsa;Pht1;4
  • Application of rice phosphate transport protein gene ORYsa;Pht1;4
  • Application of rice phosphate transport protein gene ORYsa;Pht1;4

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1. Obtainment of (gene) sequence

[0040] 1. ORYsa; Pht1; 4 gene coding region sequence acquisition

[0041] The applicant entered OsPT4 on the NCBI website (www.ncbi.nlm.nih.gov) to obtain a DNA sequence encoding the rice high-affinity phosphorus transporter gene with the sequence number AF536964. According to the requirements of Commission for Plant Gene Nomenclature of the International Society for Plant Molecular Biology, we named the DNA sequence ORYsa; Pht1;4. The analysis shows that the sequence of the full-length coding region of the gene (ie, the open reading frame, ORF) is SEQ ID NO.1, with a total length of 1617 bp, encoding 539 amino acids. This gene has no introns.

[0042] 2. ORYsa; Pht1; 4 gene promoter sequence acquisition

[0043] According to the obtained coding region sequence of ORYsa; Pht1; 4, the sequence of its promoter region (SEQ ID NO.7) was searched on the NCBI website (www.ncbi.nlm.nih.gov) and obtained.

Embodiment 2

[0044] Example 2. Identification of rice ORYsa by RT-PCR; Pht1; Spatio-temporal expression pattern of 4 genes

[0045] 1. Extraction of total RNA

[0046]The rice variety "Nipponbare" was selected, and the normal phosphorus supply (300 μM KH 2 PO 4 ) and low phosphorus (10 μM KH 2 PO 4 ) treatment, the leaves and roots were collected after 3 weeks, the total RNA was extracted with TriZol reagent, the quality of the total RNA was identified by formaldehyde denaturing gel electrophoresis, and then the RNA content was determined on a spectrophotometer.

[0047] 2. Identification of temporal and spatial expression patterns of ORYsa; Pht1; 4 genes

[0048] According to the coding sequence of the rice ORYsa; Pht1; 4 gene, the following ORYsa; Pht1; 4 gene-specific primers P1 and P2 were designed to amplify the length of 772 bp to identify the spatiotemporal expression pattern of the ORYsa; Pht1; 4 gene.

[0049] P1 ATCGTGGAGGAGCAGGAGAAGG (SEQ ID NO. 10)

[0050] P2 CATCGTCATCG...

Embodiment 3

[0053] Example 3. Using ORYsa; Pht1; 4 promoter + coding region + GUS transgenic rice plants to study the application prospect of ORYsa; Pht1; 4

[0054] The present invention utilizes the ORYsa; Pht1; 4 own promoter sequence to activate the coding region sequence of the gene.

[0055] 1. Cloning of the complete coding region sequence of ORYsa; Pht1; 4

[0056] The rice variety "Nipponbare" was selected, and the normal phosphorus supply (300 μM KH 2 PO 4 ) and low phosphorus (10 μM KH 2 PO 4 ) treatment, after 3 weeks, the materials (root tip, branch root occurrence area, rhizome junction and leaf) were collected, and the total RNA was extracted by TriZol reagent respectively, and the quality of the total RNA was identified by formaldehyde denaturing gel electrophoresis, and then the RNA was measured on a spectrophotometer content.

[0057] According to the full-length coding sequence of the rice ORYsa; Pht1; 4 gene, design primers to amplify the complete coding reading f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering and discloses application of a rice phosphate transport protein gene ORYsa;Pht1;4. Root specific expression of the rice phosphate transport protein gene ORYsa;Pht1;4 refers to a root specific expression gene which is discovered in paddy rice for the first time. The gene can be applied to the development of a rice variety which does not contain any genetically modified ingredient in paddy rice particles, can be eaten trustingly and increases the utilization ratio of available phosphorus in soil.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering and relates to the application of a rice phosphate transporter gene ORYsa; Pht1;4. Background technique [0002] 1. There are safety problems in genetically modified food [0003] Plant transgenic refers to the transfer of the target gene isolated from animals, plants or microorganisms into the plant genome through various methods to make it stable and endow the plant with new genetic traits, such as insect resistance, disease resistance, stress resistance, High yield, high quality, etc. But the safety of genetically modified food has been fiercely divided around the world. This is even more so in my country, especially since the Ministry of Agriculture approved the safety certificates for two types of genetically modified rice last November, questions about the commercialization of genetically modified rice and genetically modified corn have not stopped. In short, the safety ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/09C12N15/82C07K14/415
Inventor 徐国华孙淑斌范晓荣吴娜
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More