Metarginase and recombination expression method and use thereof
A technology of arginine deiminase and expression method, applied in the field of pharmacology of biologically active proteins and their cross-links
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Example 1: Recombinant expression of arginine deiminase
[0064] (1) Design and synthesis of 13 DNA templates of arginine deiminase:
[0065] DNA template 1:
[0066] 5'-ATGTCTGTATTTGACAGTAAATTTAAGGGAATTCATGTCTATTCAGAAATTGGTGAACTAGAAACCGTTTTAGTTCACGAACCTGGTAAAGAAATTGATTACATTACCCCAGCTCGT-3';
[0067] DNA template 2:
[0068] 5'-TAATTCAACTTCATTAATTCCACGCTTTTTAAGTTCTGCTACGAATTCTTTGTGTTCTTTTCTTGCATCGTGGCTTTCTAGAATTGCTGAGAATAATAATTCATCGAAACGAGCTGGGGTAATGTA-3';
[0069] DNA template 3:
[0070] 5'-ATTAATGTTGTTGAATTAGTAGATCTAATCGTAGAAACCTATGATTTAGCATCAAAAGAAGCTAAAGAAAAACTTTTAGAAGAATTCCTAGATGATTCAGTACCAGTT-3';
[0071] DNA template 4:
[0072] 5'-TTTTAAATCGTGTTTAGTGATCCCTGCGATCATGTATTCAACTAATTTACGAGAAGTTTTTTTAGCTTTTAAGAAATTACGAACAGTAGCTTTGTGAGCTTCTGATAGAACTGGTACTGAATCATC-3';
[0073] DNA template 5:
[0074] 5'-ACTAAACACGATTTAAAAATCGAATCAGATTTAGAATTAATCGTTGACCCAATGCCTAACTTGTACTTCACTCGTGACCATTTGCATCAGTAGGTAATGGAGTTACCATCCAC-3';
[0075] DNA template 6:
[0076] 5'-GTACC...
Embodiment 2
[0108] Example 2: Determination of Arginine Deiminase Activity
[0109] The activity of arginine deiminase is determined by the amount of citrulline produced by catalyzing arginine (see Evelyn L. Oginsky: Methods Enzymology 3 (1957): 639-643), a unit of arginine Deiminase activity was defined as the conversion of 1 micromol arginine to citrulline at 37°C.
[0110] First use citrulline samples with a concentration of 1-10mM to measure the light absorption value at a wavelength of 490nm, and make a standard curve equation as y=-0.099+0.129x, and the linear correlation coefficient is R 2 =0.99, standard curve such as image 3 shown. Mix 5 microliters of the solution to be tested with 5 microliters of 20mM arginine substrate, and react at 37°C for 15 minutes; butanedione-oxime solution), after reacting at 80 DEG C for 30 minutes, read the light absorption value reading of 490 wavelength; according to the standard curve equation of citrulline, draw arginine deiminase and activat...
Embodiment 3
[0111] Example 3: Preparation of arginine deiminase of the present invention and succinimidylcarbonate (succinimidylcarbonate, SC) polyethylene glycol cross-linked product
[0112] In terms of molar concentration, carry out cross-linking with 50 times of succinimide carbonate polyethylene glycol (molecular weight 12000, purchased from Laysan Bio Company) and the arginine deiminase obtained in Example 1: the succinimide Add amine carbonate polyethylene glycol at a concentration of 125 mg per ml, and arginine deiminase at a concentration of 10 mg per ml to 0.1M sodium phosphate buffer (pH 8.0), and mix and react at 4°C for 60 minutes Add the reaction product to the Superdex 200 chromatographic column and elute with 50mM sodium phosphate buffer (pH6.5) containing 150mM sodium chloride to obtain arginine deiminase and succinimide carbonate poly Glycol cross-linked product. As determined by the method of Example 2, the cross-linked product of arginine deiminase and succinimide car...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com