Fluorescent biosensing method for detection of interaction between small organic molecules and binding proteins based on restriction endonuclease foki inhibition assay
A technology of restriction endonuclease and binding protein, which is applied in the field of fluorescent biosensing based on restriction enzyme FokI inhibition analysis to detect the interaction between organic small molecules and binding protein, which can solve the problem of poor reliability and low sensitivity of detection technology , can not meet the problems of accurate and fast detection, and achieve the effect of simple design and fast and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0024] Example 1: Detection of biotin based on restriction endonuclease FokI inhibition assay
[0025] 1) Cross-linking of intermediate amino-labeled oligonucleotide DNA strands and biotin
[0026] Weigh 6.1 mg of biotin and dissolve it in 2.5 mL of phosphate buffer solution (0.1 M NaH 2 PO4, pH 7.4), then add 1 mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stir at room temperature for 15 min, then add 2.8 mg
[0027] N-hydroxysuccinimide (NHS) was reacted at room temperature for 30 min. 260 μl of activated biotin solution was added to 260 μl of 10 μM concentration of intermediate amino-labeled oligonucleotide DNA single strand (GAACAACAACCAACATCCAAACTTCTATATATGGATGAAT(NH2)CAAC) solution, and reacted at room temperature for 2 h under slight stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixture to terminate the reaction.
[0028] The cross-linking reaction product was transferred to a 1 mL dialysis tube with a molecular we...
Embodiment 2
[0031] Example 2: Detection of folate-binding proteins based on restriction endonuclease inhibition assays
[0032] 1) Cross-linking of oligonucleotide DNA single strands labeled with intermediate amino groups and folic acid
[0033]Weigh 10mg of folic acid and dissolve in 2.5mL phosphate buffer solution (0.1M NaH 2 PO4, pH 7.4), then add 1mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stir at room temperature for 15min, then add 2.8mg of N-hydroxysuccinate Imide (NHS), react at room temperature for 30min. Take 260 μl of the activated folic acid solution and add it to 260 μl of 10 μM intermediate amino-labeled oligonucleotide DNA single strand (GAACAACAACCAACATCCAAACTTCTATATGGATGAAT(NH2)CAAC) solution, and react at room temperature for 2 hours under gentle stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixed solution to terminate the reaction.
[0034] Transfer the cross-linked reaction product to a 1 mL dialysis tube with ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com