Human apolipoprotein AV monoclonal antibody and application thereof
A monoclonal antibody and apolipoprotein technology, applied in the direction of anti-animal/human immunoglobulin, biochemical equipment and methods, instruments, etc., can solve the problems such as no reports of ApoAV monoclonal antibodies, and achieve a linear detection range Large and stable effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 , Antigen preparation
[0030] Using EX-W0804-B01 (purchased from GeneCopoeia) as a template, using F.primer and R.primer as primers, perform PCR amplification, and then connect the obtained PCR product to the PQE30 vector to obtain recombinant strains, and ferment them And purify to obtain the desired antigen, the specific process is as follows:
[0031] 1. Primer design
[0032] According to the sequence of the target gene Genbank Acc#: NM_052968.3, design primers F.primer and R.primer, and their sequences are as follows:
[0033] F. primer: CGC GGATCC GCACGGAAAGGCTTCTGGGA;
[0034] R. primer: CCC AAGCTT TCAGGGGTCCCCCAGATGGCT.
[0035] Among them, the underlined marks in the primers F.primer and R.primer are their BamH I and Hind III restriction sites, respectively.
[0036] 2. PCR amplification
[0037] Using EX-W0804-B01 (purchased from GeneCopoeia) as a template and using F.primer and R.primer as primers, PCR amplification was carried out. The ...
Embodiment 2
[0047] Example 2 , Preparation of monoclonal antibodies
[0048] Using human serum lipoprotein AV as an antigen, Balb / c mice were used as immunization objects to prepare monoclonal antibody cells, and the obtained stable positive monoclonal antibody cells were cultured and purified to obtain human serum lipid Monoclonal antibody to protein AV, the specific process is as follows:
[0049] 2.1. Animal immunity
[0050] With Balb / c mice (purchased from Shanghai Experimental Animal Center, Chinese Academy of Sciences) as the immunization object, the human serum lipoprotein AV prepared in Example 1 was used as the antigen, and the animal was immunized according to the immunization scheme in Table 1, wherein, the first -4 times of immunization by subcutaneous immunization, and the fifth time by tail vein injection for booster immunization, and 4 days after immunization, the immunized Balb / c mice were sacrificed, and the splenocytes were harvested for use in cells fusion.
[005...
Embodiment 3
[0059] Example 3 , human serum lipoprotein detection
[0060] Serum samples were collected from 505 cases of outpatient physical examination in the Second Xiangya Hospital of Central South University from June to July 2006, including 259 males and 246 females, aged 20-76 (average 44±12) years old; diabetes, hyperlipidemia, hyperlipidemia were excluded Blood pressure, kidney disease, tumor and other immune system diseases, and TG≤2.4mmol / L, TCHO≤5.6mmol / L in blood lipid test results. In the morning, 2ml of blood was drawn on an empty stomach and placed in a quick-clotting tube, placed at room temperature for 2 hours, then centrifuged at 3000r / min, and the serum was taken for later use.
[0061] With the monoclonal antibody of the human serum lipoprotein AV prepared in embodiment 2, carry out westernblot or ELISA detection according to the following scheme:
[0062] 3.1, western blot detection
[0063] The obtained monoclonal antibody was used as the primary antibody, and HR...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com