Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Test paper strip for detecting morbilli and rubella virus IgM antibody colloidal gold, method for making same and applications

A technology for rubella virus and test strips, which is applied to measurement devices, instruments, scientific instruments, etc., can solve problems such as lack of diagnostic criteria for PCRRV infection, and achieve the effects of saving manpower and material resources, being easy to popularize, and having clear and identifiable results.

Active Publication Date: 2009-02-11
辽宁迪浩生物科技有限公司
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still a lack of diagnostic criteria for PCR detection of RV infection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper strip for detecting morbilli and rubella virus IgM antibody colloidal gold, method for making same and applications
  • Test paper strip for detecting morbilli and rubella virus IgM antibody colloidal gold, method for making same and applications
  • Test paper strip for detecting morbilli and rubella virus IgM antibody colloidal gold, method for making same and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Cloning and expression of embodiment 1 measles virus H antigen and rubella virus E1 specific antigen

[0037] (1) Amplification of the MV-H protein gene

[0038] MV genomic RNA was extracted according to the Trizol method, and then the first strand of cDNA was synthesized according to the instructions of the reverse transcription kit. (The GenBank accession number of the MV.H gene is AB045300) and primers 5'CGCA AGCTTCTATCTGCGATTGGTTCCA3' and

[0039] 5'TTAGGATCCATGTCACCACA ACGAGACCG3'

[0040] Under the action of high-fidelity DNA polymerase, the MV-H gene was amplified under the conditions of 95°C for 3min; 94°C for 30S, 54°C for 35s, 72°C for 105S, and 30 cycles; and then extended at 72°C for 10min. The product was purified by PCR Product (Mini) Purification Kit.

[0041] virus recombination

[0042]The MV-H gene and the vector pGEMEX-1 (Promega) were placed in the double enzyme digestion system of BamHI and Hind-III, respectively, in a water bath at 37°C for 1 h...

Embodiment 2

[0058] Embodiment 2: measles, rubella virus IgM antibody quick detection test strip (seeing Fig. 1)

[0059] (1) Preparation of colloidal gold-antibody conjugates:

[0060] It has been determined by experiments that the optimal binding pH of the colloidal label of anti-human IgM monoclonal antibody is 8.0, and the ratio of colloidal gold and antibody is 18 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), the labeled colloidal gold antigen is diluted to OD2.0, and the colloidal gold-antibody conjugate solution is taken in an amount of 65 μl per square centimeter , evenly adsorbed on the glass fiber, freeze-dried, and stored in a dry environment.

[0061] (2) Coating antigen on nitrocellulose membrane:

[0062] Dilute measles virus H antigen and rubella virus E1 antigen to 3.5mg / ml with 0.01M PBS. Anti-mouse IgG polyclonal antibody was diluted to 2mg / ml with 0.01MPBS. Spray the two on the nitrocellulose...

Embodiment 3

[0069] Embodiment 3 detection method (see figure 2 )

[0070] The sample to be tested (whole blood, plasma or serum) is directly dropped into the "4" place of the test strip of Example 2, the sample solution goes up the membrane, and the result is interpreted within 10-15 minutes.

[0071] result:

[0072] If the sample contains measles virus and rubella virus IgM antibodies, it will form a corresponding complex with the colloidal gold-labeled anti-human IgM monoclonal antibody on the test strip, and go upstream with the measles virus H antigen and rubella virus coated on the nitrocellulose membrane. The combination of virus E1-specific antigens forms red lines, that is, red bands are formed at T1 and T2.

[0073] Regardless of whether it contains the corresponding antibody or not, the colloidal gold-labeled anti-human IgM monoclonal antibody continues to crawl upward and forms a red precipitation line with the anti-mouse IgG coated on the membrane, that is, a red band is f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a colloidal gold test strip for the detection of measles and rubella virus specific IgM antibodies. The measles specific gene engineering antigen H, the rubella virus specific gene engineering antigen E1, and a quality control double-antibody IgG are simultaneously coated on a nitrate cellulose film (NC film), and a membrane chromatography double antigen sandwich method is adopted to detect the measles and rubella virus specific IgM antibodies in a specimen in combination with a colloidal gold labeled anti-human IgM. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base and site detection and epidemiological investigation, has auxiliary and differential diagnosis effects on measles and rubella virus infection, and can be used for the immune effect observation after vaccination.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a measles and rubella virus IgM antibody colloidal gold detection test strip, a preparation method and application thereof. Background technique [0002] Measles virus (MV) infection can not only cause acute infection symptoms such as fever, respiratory catarrh, and systemic maculopapular rash, but also inhibit cell-mediated immunity, leading to secondary infections such as pneumonia and diarrhea. In a small number of cases, it can even cause serious complications such as encephalitis and persistent central nervous system infection. MV-H protein (hemagglutinin protein) belongs to type II transmembrane glycoprotein with a molecular weight of 73-78kD, which can stimulate the body to produce effective humoral immunity and cellular immunity. MV-H protein is the main site of MV two types of receptors CD46 and SLAM, and initiates the infection of the virus; at the same ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569G01N33/558G01N33/545
Inventor 刘明
Owner 辽宁迪浩生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com