Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human proinsulin-KGD chimeric peptide as new recombinat antithrombotic with thrombocyte GP-IIb-IIIa receptor specificity

A technology of human insulin and chimeric peptides, which is applied in the direction of carrier binding/immobilizing peptides, medical preparations containing active ingredients, hybrid peptides, etc., to achieve the effects of no pollution to the environment, simple purification process, and high anti-platelet aggregation inhibitory activity

Inactive Publication Date: 2006-08-02
BEIJING NORMAL UNIVERSITY
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disintegrating proteins Barbourin and Ussuristatin-2 are highly receptor-specific and highly effective platelet aggregation inhibitors, and have remarkable characteristics in antithrombotic formation, but they are all derived from snake venom. For the human body, It has strong immunogenicity, and it will produce a strong immune response after direct injection into the human body, so it is not suitable for direct application as a drug in clinical medical practice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human proinsulin-KGD chimeric peptide as new recombinat antithrombotic with thrombocyte GP-IIb-IIIa receptor specificity
  • Human proinsulin-KGD chimeric peptide as new recombinat antithrombotic with thrombocyte GP-IIb-IIIa receptor specificity
  • Human proinsulin-KGD chimeric peptide as new recombinat antithrombotic with thrombocyte GP-IIb-IIIa receptor specificity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1. Construction of human proinsulin-KGD chimeric peptide gene

[0028] Experimental Materials:

[0029] Strains: E.coli DH5α, BL21(DE3)pLysS, JM109 are all commercially available products.

[0030] Primers: DNA fragments of oligonucleotide primers were synthesized by Beijing Saibaisheng Company. Primer 1: 5'CCCAAGCTTGAATTCACATG A3'; Primer 2: 5'GAAGAAGCGGCTTTAGCCAGCTTCCCTTTGCCCACCTGCACATA3'; Primer 3: 5'CATAAGCCGCTGTC 3'; Primer 4: 5'GTGGCGCTGATCACCC3'.

[0031] Chemical reagents and enzymes: common restriction enzymes, T4 DNA ligase, Klenow fragment, T4 DNA polymerase, T4 polynucleotide kinase, Taq DNA polymerase, RNase, ATP, dNTPs, IPTG, TEMED, etc. were purchased from Promega , Huami Biotechnology Corporation or Takara Biotechnology Corporation. pET21a vector was purchased from Novagen, USA. DNA wizard plus Miniprep DNA purification system was purchased from Promega. Ultra-pure urea, acrylamide, methylene bisacrylamide and Tris are...

Embodiment 2

[0040] Example 2. Expression and purification of human proinsulin-KGD chimeric peptide mutant in Escherichia coli expression system

[0041] The Escherichia coli expression strain with recombinant mutant gene was fermented and cultured. When the bacterial growth in the culture solution reaches the logarithmic phase, IPTG is added to induce the expression of the gene, and the expression time is 5-7 hours. Then, the wet bacterial cells fermented and cultured were collected and centrifuged. Suspend the above-mentioned fermented bacteria in STET solution, ultrasonically disrupt E. coli, etc., centrifuge the treated solution at 10,000g, 4°C, 10 minutes, collect the precipitate after centrifugation, and dissolve the precipitate with inclusion body lysate, 4 Stir overnight at ℃, add dithiothreitol to the solution to a final concentration of 15-20mM, let it stand at room temperature for 2 hours, expand the total volume of the solution with 5 times the volume of pre-cooled water, a...

Embodiment 3

[0042] Example 3. Research on important physicochemical properties of human proinsulin-KGD chimeric peptide

[0043] 1. Determination of molecular weight

[0044] The mass spectrometry detection experiment was completed by the mass spectrometry laboratory of the Analysis and Testing Center of Beijing Academy of Military Medical Sciences. For specific steps, refer to the product instruction manual of the mass spectrometer of the United States HP company and the instruction manual of the detection software package. The results are attached Figure 4 shown. The measured molecular weight of human proinsulin-KGD chimeric peptide is 6303Dalton, compared with its theoretically calculated value (MW=6322Dalton), the error is 0.3%, which is within the allowable error range of mass spectrometry, which proves that the measurement result is true and reliable. The measurement results showed that the purified product of human proinsulin-KGD chimeric peptide recombinant protei...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention obtains human proinsulin-KGD peptide protein molecule based on modern biochemical technology, by using the human proinsulin mutant, (CysA6Serú¼CysA11Serú¼DeltaB29- B30ú¼Delta A1)-human proinsulin, as molecular rack and through specific replacement with functional sequence CAKGDWNC containing Lys-Gly-Asp(KGD) in the original C peptide position. It is expressed effectively in pronucleus cell-colibacillus expression system, and the expressed product is purified through ultrasonic crushing, isoelectric precipitation, molecular sieve chromatographic separation, ion exchange chromatographic separation and other steps. The physical and chemical property analysis and the biological function detection show that the human proinsulin-KGD peptide protein has excellent molecular homogeneity, high GPIIb-IIIa acceptor recognizing and combining activity, powerful blood platelet coagulation inhibiting activity, no insulin hormone activity and no immunogenicity.

Description

technical field [0001] The invention relates to the field of biotechnology, more precisely, a novel antithrombotic agent developed based on modern genetic engineering technology and protein engineering downstream purification technology, and its design, preparation and application characteristics. Background technique [0002] Proinsulin is the precursor protein of insulin. Insulin is a type of hormone that is normally secreted by the β-cells of the human pancreas. Its main function is to regulate the degradation and metabolism of blood sugar and promote the oxidation and decomposition of blood sugar. Therefore, it has the effect of reducing the glucose content in the blood. Under normal circumstances, the formation and degradation of glucose in the blood reach a dynamic balance and remain within a stable concentration range. When the secretion of insulin in the body is insufficient, or the body is desensitized to the insulin hormone due to pathological reasons, the glucose...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K17/02C07K19/00A61K38/16A61P9/00A61P7/00A61P43/00
Inventor 井健
Owner BEIJING NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com