Gene chip internal reference, preparation method and application thereof
A gene chip hybridization and internal reference technology, applied in the field of gene chip detection of gene mutation or genotype, to achieve the effect of improving accuracy and sensitivity, reducing primer and template competition, and simple method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Embodiment 1. Selection of the internal reference template of the gene chip
[0044] From E.coli chromosomal region from 89.2 to 92.8minutes, GeneBank accession number: U00006. A part of the gene sequence was cloned by our laboratory, the full length is about 500bp, and it was cloned into the T vector. Sequence analysis showed that one of the sequences was very similar in base composition to the amplified fragment of the HCV 5' non-coding region, and had no special secondary structure, so primers were designed based on this sequence.
[0045] GCGTTATTTGAGGAGAACGGCTGAGTGCGGTT
[0046] GCCAGACCGGCAGCGTATTACTCCAGGGCGTCGGCAAACTGACCTGCT
[0047] CTGTCCGGCTGTAGTGCGTTATCCAGCGCCTGCGCCGAGTTCCAGGTGGC
[0048] ATCCCAGG
Embodiment 2
[0049] Example 2. Design of primers and preparation of internal reference
[0050] 1. Synthesis of primers
[0051] Both sides of the above sequence are directly connected to the inner primer sequence (shaded part) of the nested PCR of the HCV 5' non-coding region. The primer synthesis is entrusted to Boya Bioengineering Co., Ltd.
[0052] taggcgggtgtctcttcaa
[0053] agggccgcgatcttcttcacg
[0054] The primers are used to amplify the above-mentioned gene plasmids, and the amplified products are purified.
[0055] Then synthesize the second pair of primers, which are combined by the inner and outer primers of HCV nested PCR, design the PCR program according to the primer conditions, use the above-mentioned purified PCR product as a template, and perform PCR amplification again.
[0056] The amplified product was purified again and ligated into a T vector to make a clone.
[0057] 2. Product purification and quantification
Embodiment 3
[0078] Example 3. Preparation and preliminary quantification of internal reference plasmids
[0079] Thaw the preserved strain, shake the bacteria, and then use Qiagen's Hispeed Plasmid Midi kit for plasmid extraction. The specific method is operated according to the Hispeed Plasmid Midi kit protocol. Finally, an ultraviolet spectrophotometer was used to measure the OD260 / 280 value of the plasmid solution. The OD value was equal to 1.83, and the purity had met the requirements; the concentration was measured, the plasmid was quantified, and the solution was diluted to 106 copies / ml and stored at -20°C for later use.
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com