Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pig transmissible gastroenteritis virus and application thereof

A technology for infectious and gastroenteritis, applied in the direction of viruses, antiviral agents, virus antigen components, etc., can solve the problems of poor immune effect of vaccines, etc., to overcome the poor protection ability of vaccines, good stability, and convenient transportation and storage Effect

Pending Publication Date: 2022-03-01
GUANGZHOU GREAT BIOLOGICAL TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the deficiencies of the prior art and actual needs, the present invention provides a porcine transmissible gastroenteritis virus and its application, which can effectively solve the problem of poor immune effect of existing vaccines due to strain variation, and the preparation method is simple and the production cost is low. low, with practical value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig transmissible gastroenteritis virus and application thereof
  • Pig transmissible gastroenteritis virus and application thereof
  • Pig transmissible gastroenteritis virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] The present embodiment isolates porcine transmissible gastroenteritis virus, and the separation steps are as follows:

[0078] (1) Collect 200 μL of sick pig feces and place them in a sterile EP tube, mix with 1 mL of PBS solution with a pH of 7.4, freeze at -20°C, thaw at 37°C, repeat 3 times, shake for 15 seconds and centrifuge at 3000 rpm After 2 minutes, the supernatant was collected and filtered with a 0.22 μm filter to obtain the crude virus extract, which was stored at -70°C for later use;

[0079] (2) The ST cells covered with a single layer were subcultured at a ratio of 1:4. After the cells were dispersed by pipetting, they were divided into cell culture flasks, and each bottle was supplemented with 15 mL of MEM containing 5% FBS;

[0080] (3) Inoculate the obtained virus crude extract in ST cells, the inoculated dose is 200 μL, at 37 ° C, 5% CO 2 The cell culture solution is collected when the cytopathic rate is not lower than 80%, and the porcine transmissi...

Embodiment 2

[0083] In this embodiment, the porcine transmissible gastroenteritis virus isolated in Example 1 is identified by RT-PCR, genetic evolution analysis and TCID 50 Determination.

[0084] RT-PCR identification

[0085] Take the diseased cell culture, use the RNA extraction kit to extract RNA according to the instructions, and reverse the RNA into cDNA according to the instructions of the reverse transcription kit, and use normal cells to perform the same operation as a negative control. The obtained cDNA is used as a template for amplification to amplify the S1 gene, and the primer sequences used for the amplification are shown in SEQ ID No.1-2.

[0086] SEQ ID No. 1: ACTAAGCTTTTAGCTTACATCACATGGCGTTACAG;

[0087] SEQ ID No. 2: ACTGGATCCATGAAAAAATTATTTGTGGTTTTGG.

[0088] The amplification system is as follows:

[0089]

[0090]

[0091] The amplification procedure is as follows:

[0092] Pre-denaturation: 95°C, 4min;

[0093] Cycle amplification: 98°C, 10s; 60°C, 30s;...

Embodiment 3

[0104] RT-PCT identification, genetic evolution analysis and TCID based on embodiment 2 50 As a result of the determination, it was confirmed that the isolated virus was a new epidemic strain of porcine transmissible gastroenteritis virus, named porcine transmissible gastroenteritis virus TGEV-HuN, and it was preserved in China Microorganisms on June 2, 2021 The General Microorganism Center of the Preservation Management Committee, the address is No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, postcode 100101, and the deposit number is CGMCC No.20279.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a swine transmissible gastroenteritis virus and application thereof, the swine transmissible gastroenteritis virus is named as swine transmissible gastroenteritis virus TGEV-HuN, and is preserved in China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.20279, and the preservation date is June 2, 2021. The invention also provides a separation method of the swine transmissible gastroenteritis virus, a swine transmissible gastroenteritis vaccine and a preparation method of the swine transmissible gastroenteritis vaccine. The swine transmissible gastroenteritis virus has high toxicity and infectivity, after the swine transmissible gastroenteritis virus is prepared into a vaccine, the immunogenicity is far higher than that of a traditional virus strain, offspring of immunized sows also has resistance to the swine transmissible gastroenteritis virus, and the defect that the vaccine protection capacity of the traditional virus strain vaccine is poor due to virus strain variation is overcome; the stability is good, the preparation method is simple, the cost is low, and the application prospect is wide.

Description

technical field [0001] The invention belongs to the technical field of vaccine preparation, in particular to a porcine transmissible gastroenteritis virus and its application. Background technique [0002] Porcine transmissible gastroenteritis virus (TGEV) can cause intestinal infectious diseases mainly characterized by severe diarrhea, vomiting, dehydration and loss of appetite, the incidence rate can be as high as 100%, and the mortality rate is 30%-80 %, is one of the main diseases that cause piglets to die early, and has caused huge economic losses to the pig industry in many countries. [0003] At present, there are some methods for the prevention and treatment of porcine transmissible gastroenteritis virus. CN112080455A discloses a recombinant Lactococcus lactis expressing and secreting anti-porcine transmissible gastroenteritis virus single-chain antibody and its preparation method, which can infect pigs by secreting and expressing the fusion sequence of anti-porcine...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/00C12N7/02A61K39/225A61P31/14
CPCC12N7/00A61K39/12A61P31/14C12N2770/20021C12N2770/20034C12N2770/20051A61K2039/552A61K2039/5252A61K2039/5254
Inventor 魏平华
Owner GUANGZHOU GREAT BIOLOGICAL TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com