Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Daptomycin high-yield strain and application thereof

A daptomycin, high-yield technology, applied in the field of genetic engineering, can solve the problems of low tolerance and low yield of daptomycin, achieve the effect of increasing yield, improving tolerance and utilization rate, and broad application prospects

Pending Publication Date: 2021-11-30
HANGZHOU ZHONGMEI HUADONG PHARMA +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The object of the present invention is to provide a kind of daptomycin bacterial strain and its construction method that improves capric acid utilization rate and tolerance, to solve Streptomyces roseospora low precursor tolerance and daptomycin in the prior art Technical problems of low yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Daptomycin high-yield strain and application thereof
  • Daptomycin high-yield strain and application thereof
  • Daptomycin high-yield strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: Construction of the pSET152CRP comprising the recombinant plasmid of CRP gene:

[0036] Blast the nucleotide sequence of the homologous gene CRP reported in Streptomyces coelicolor with the genome sequence of Streptomyces roseospora from NCBI (website: www.ncbi.nlm.nih.gov), and obtain the The target gene CRP, its size is 672bp.

[0037] Primers were designed with primer 5.0 as follows:

[0038] CRPS: ATTTCTAGAAATACCTGACCGAGCACG;

[0039] CRPA: ATTGGATCCATCGCACTGTTTTACCGT.

[0040] The total DNA of Streptomyces roseospora was extracted, and the CRP gene was amplified to obtain the target gene fragment.

[0041] Use the SanPerp Column Plasmid DNA Mini-Extraction Kit to extract the pSET152 plasmid according to the kit instructions. The resulting plasmid DNA solution was stored at -20°C or used for subsequent experiments.

[0042] Treat the pSET152 plasmid with restriction endonucleases, perform DNA agarose gel electrophoresis after digestion, and use th...

Embodiment 2

[0047] Example 2: Transfer of Recombinant Plasmids to Streptomyces roseospora by Intragenus Conjugation

[0048] Escherichia coli ET12567 containing the recombinant plasmid PSET152CRP was conjugatively transferred to Streptomyces roseospora NO.CGMCC4.7231, and a zygote containing the PSET152CRP plasmid was obtained by screening with apramycin and nalidixic acid. Plasmid vectors were used as controls.

[0049] Method for indirect conjugative transfer of Escherichia coli and Streptomyces roseospora NO.CGMCC4.7231:

[0050] Inoculate ET12567 (PUZ8002 / PSET152) and ET12567 (PUZ8002 / PSET152CRP) into LB (containing kanamycin / chloramphenicol / ampicillin) medium and culture overnight at 37°C in a shaker at 220rpm. Transfer ET12567 (PUZ8002 / PSET152) and ET12567 (PUZ8002 / PSET152CRP) to fresh LB medium (containing kanamycin / chloramphenicol / ampicillin) at a ratio of 1:100, shake at 220 rpm at 37°C Cultivate in bed until OD600 reaches 0.3-0.4. Resuspend the cells twice with the same volume ...

Embodiment 3

[0055] Embodiment 3: Recombinant bacteria fermentation process

[0056] After the constructed Streptomyces roseospora strain was cultured in R5 slant medium at 30°C for 5 days, it was transferred to a shaker flask containing 50ml of YEME liquid medium, and cultured at 30°C for 25 hours with shaking (220rpm / min). Feed capric acid as the fermentation precursor, cultivate until the end of fermentation, and select the strain with the highest yield. attached by the manual figure 1 Shown compared with existing Streptomyces roseosporus (starting bacterium), the high antibiotic production Streptomyces roseospora that makes in the present invention has higher fermentation yield, just has better daptomycin yield, fermentation Yield increased by more than 200%.

[0057] TSB liquid medium formula:

[0058] Tryptone 17g, soybean peptone 3g, D-glucose 2.5g, sodium chloride 5g, dipotassium hydrogen phosphate 2.5g, add deionized water to 1000ml, sterilize at 121°C for 30min.

[0059] R5 m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a daptomycin high-yield strain and a preparation method thereof. The classification name of the recombinant strain is Streptomyces roseosporus, and the preservation number of the recombinant strain is NO.CGMCC (China General Microbiological Culture Collection Center) 18297. By using a global regulatory factor CRP, the problems of high workload and high blindness of traditional streptomyces breeding are solved, the daptomycin high-yield strain cultured by genetic engineering is obtained, and the application prospect is wide; the method is utilized to modify the starting strain streptomyces roseosporus, and the obtained recombinant strain can improve the tolerance of the streptomyces roseosporus to capric acid, the utilization rate of the capric acid and the yield of daptomycin.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a daptomycin high-yield bacterial strain and a preparation method thereof. Background technique [0002] Daptomycin is a novel cyclolipopeptide antibiotic produced by Streptomyces roseosporus, which interacts with the cell membrane in a calcium ion-dependent manner and exerts bactericidal activity. In December 2010, the US FDA approved a new dosing regimen for Cubist Pharmaceutical Co., Ltd.'s daptomycin (daptomycin) injection, Cubicin, which is intravenously injected once a day for 2 minutes. Cubicin was first approved in the United States in 2003 for the treatment of complicated skin and skin tissue infections caused by certain Gram-positive bacteria, including methicillin-resistant Staphylococcus aureus, by intravenous infusion once a day for 30 minutes In 2006, it obtained new indications for the treatment of bacteremia caused by methicillin-sensitive and resista...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/76C07K7/08C12P21/02C12R1/465
CPCC07K7/08C12N15/76C12P21/02C12N15/74C12P19/26
Inventor 吴杰群张薇平丽英沈建宇杨永梅方丽纳徐金勇吴金荣范萍吴骏
Owner HANGZHOU ZHONGMEI HUADONG PHARMA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com