Monoclonal antibody for resisting B cell maturation antigen and application of monoclonal antibody
A monoclonal antibody and B cell technology, applied in the field of biomedicine, can solve problems such as obvious side effects and insufficient clinical data
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060]This example is used for the construction of phage monoclonal antibody libraries and preliminary screening using ELISA. Specific steps are as follows:
[0061](1) Construction of phage monoclonal antibody library
[0062]After the expression of BCMA-Fc immunopoly peak camel, ELISA, ELISA, which express the extracellular zone, extract 200ml peripheral blood; select lymphocytes, obtain peripheral blood mononuclear lymphocytes precipitation, extract RNA;The III reverse transcription enzyme synthesis the first chain cDNA in RNA, and then expands the VHH gene using a nest type PCR; insert the VHH gene into the Pmecs phage display carrier, after electro-conversion of TG1, take a proper amount of bacterial liquid for library identification All the remaining cultures are evenly applied to the lb / ampglu plate. After the bacterium is long, collect the moss, add 1 / 3 volume of 50% glycerol, mix well, save, to obtain the storage capacity greater than 109Phage display camel VHH immune library.
[...
Embodiment 2
[0076]In this embodiment, the candidate clone was screened using Fluorescence Activated Cellsorting (FACS).
[0077]Cell culture was carried out according to standard cell culture regimen, and BCMA positive and negative cell suspensions were prepared using trimming. 300g centrifugal 5min removal culture solution, resuspended by Flow buffer to 2 × 106Cell / ml; add 2 × 10 to each of the 96-well plates in V-shaped bottom5A cell, 300 g of centrifugation for 5 min, removes the supernatant, and the VHH antibody was added to resuspend the cells, and incubated at 4 ° C for 1 h;
[0078]After 300g centrifugation 5min, remove the supernatant, Flow Buffer resuspended cells, using Flow buffer to dilute the APCANTI-His antibody to 2 μg / ml, 10 μl of resuspension cells per well, incubation for 1 h at 4 ° C; Flow buffer cleaning cells 3 times after 3 times, using 200 μl Flow buffer Resusted cells and transformed cytometry.
Embodiment 3
[0080]In this example, the VHH-MIGG2A Fc monoclonal antibody is expressed and purified, and the assay of antibody affinity is performed. In order to further identify the selected antibodies, the antibody is used to express the antibody by mammalian cells. Therefore, a plasmid vector with a mouse Fc tag expression vhh is constructed, which is recorded as C-4PCP.stuffer-MCG2A-Fc, and the specific steps are as follows:
[0081]1. Use PCR amplification BCMA VHH B46, which is:
[0082]HD-f (SEQ ID NO.10):
[0083]CGCGATTTTAAGGGTGTCCAGTGCGAGGTGCAGCTGTGTGGA;
[0084]HD-B46-R (SEQ ID NO.11):
[0085]Gcatggggacagggcttgattgtgggagagctcactgtcacctg
[0086]The reaction system is shown in Table 2, and the amplification procedure is shown in Table 3 below:
[0087]Table 2
[0088]
[0089]table 3
[0090]
[0091]2, the enzyme digestion is shown in Table 4, the enzyme digested temperature is 37 ° C, the time is 6 h, and the carrier after the exchanger is used.The PCR purification kit was purified, and the obtained DNA was dissolv...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com