Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel coronavirus single-chain antibody, quality control product and preparation method

A single-chain antibody and virus technology, applied in the field of immunoassay, can solve the problems of insufficient stability and sensitivity, inability to carry out accurate and effective determination, etc., to improve molecular stability and specific binding ability, easy reconstitution and mixing , good stability

Active Publication Date: 2021-03-23
SHENZHEN YHLO BIOTECH
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

2019-nCoV antibody detection has been widely used in ELISA, colloidal gold, lateral flow chromatography, chemiluminescence and other platforms, but the general quality control antibody cannot be accurately and effectively measured due to insufficient stability and sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel coronavirus single-chain antibody, quality control product and preparation method
  • Novel coronavirus single-chain antibody, quality control product and preparation method
  • Novel coronavirus single-chain antibody, quality control product and preparation method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0032] The preparation method of the new coronavirus antibody quality control product of an embodiment of the present invention comprises the following steps:

[0033] The new coronavirus antibody is mixed with the freeze-drying protection solution to obtain the antibody solution.

[0034] The antibody solution was subjected to pre-freezing treatment, primary drying treatment and secondary drying treatment in sequence to obtain the new coronavirus antibody quality control product.

[0035]The condition parameters of the above pre-freezing treatment are as follows: partition temperature -5℃~-15℃ for 35~45min, partition temperature -45℃~-55℃ for 80~100min, partition temperature -20℃~-30℃ Treat for 80 to 100 minutes, and the partition temperature is -50°C to -60°C for 80 to 100 minutes. The condition parameters of the above-mentioned one-time drying treatment are as follows: partition temperature -50℃~-60℃, vacuum degree 0.2mbar~0.4mbar for 6~10s, partition temperature -50℃~-60℃...

Embodiment 1

[0042] 1. Preparation of whole mouse IgM monoclonal antibody

[0043] Animal immunization: Protein synthesis was carried out according to the N gene sequence published by China CDC, and N protein was synthesized by Anhui General Biotechnology. The N gene sequence is shown below. Mice were immunized with the prepared 2019-nCoV N protein as an immunogen to prepare whole mouse IgM monoclonal antibodies. Equal amounts of N protein and Freund's adjuvant were mixed and fully emulsified, and three Balb / c mice were injected with 25 μg each, and immunized three times with an interval of 15 days.

[0044] N gene sequence:

[0045] GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGG

[0046] Cell fusion: 3 days before fusion, mice were intraperitoneally injected with 25 μg of coupling protein, and the spleen cells of immunized mice were taken out, and 2.0×10 7 2.0×10 SP2 / 0 myeloma cells 8 The splenocytes of 1 immunized Balb / c mouse wer...

Embodiment 2

[0080] Example 2 Preparation of new coronavirus IgM antibody quality control product

[0081]Raw material processing and concentration confirmation: take the above-mentioned IgM chimeric antibody raw materials out of the refrigerator under storage conditions and thaw them, and process the raw materials in the biological safety cabinet of the 100,000-level production workshop. Virus Antibody Assay Kit, Human Immunodeficiency Virus Antigen Antibody Assay Kit, and Treponemal pallidum Antibody Assay Kit are tested, and raw materials with negative or non-reactive test results are selected, and then the concentration of 2019-nCoV IgM chimeric antibody raw materials is determined. Then centrifuge and filter to obtain clarified antibody raw materials, and confirm the antibody concentration in a 100,000-level production workshop.

[0082] Solution preparation: The freeze-dried solution is prepared in a 100,000-level production workshop. The preparation process is as follows: taking 1L...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel coronavirus single-chain antibody, a quality control product and a preparation method. The novel coronavirus single-chain antibody sequentially comprises a light chainvariable region and a heavy chain variable region from the N section to the C end, wherein an amino acid sequence of the light chain variable region is as shown in SEQ ID NO:1, and an amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO:2. The novel coronavirus single-chain antibody is high in sensitivity, good in stability and very suitable for preparation of the quality control product. Moreover, on the basis of the sequences of the variable regions, a gene recombination technology is further used for constructing and forming a CH1 fragment-free human-mouse chimeric IgM antibody, so that the molecular stability and the specific binding capacity are improved. The prepared novel coronavirus single-chain antibody can be applied to a chemiluminescence platform forquality control product detection, the activity can be effectively determined, and the defects that a common 2019-nCoV IgM antibody is poor in detection sensitivity and low in specificity can be overcome.

Description

technical field [0001] The invention relates to the technical field of immunoassay, in particular to a novel coronavirus single-chain antibody, a quality control product and a preparation method. Background technique [0002] 2019 Novel Coronavirus (2019-nCoV), named "2019-nCoV" by the World Health Organization on January 12, 2020, and "Severe Acute Respiratory Syndrome Coronavirus 2" by the International Committee on Taxonomy of Viruses on February 11, 2020 (SARS-CoV-2)”. The novel coronavirus is a new strain of coronavirus that has never been found in humans before113. Coronaviruses are a large family of viruses known to cause colds as well as more serious illnesses such as Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS). The similarity between 2019-nCoV and SARS virus in the whole genome is about 80%. From the current cognition, in terms of toxicity, 2019-nCoV is weaker than SARS, and in terms of infectivity, because 2019-nCoV has a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/10C12N15/13G01N33/531G01N33/569
CPCC07K16/10G01N33/531G01N33/56983C07K2317/622C07K2317/52C07K2317/56G01N2496/80G01N2333/765G01N2333/165
Inventor 江章涛何雨禧魏道舜林晓涛邢智浩钱纯亘王刚林军李一荣潘运宝胡鹍辉
Owner SHENZHEN YHLO BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com