Neospora attenuated strain with double deletion of grx S16 and grx C5 genes and its construction method and application

A technology of Neospora and a construction method, which is applied in the field of genetic engineering to achieve the effects of reducing pathogenicity and preventing reinfection

Active Publication Date: 2022-08-02
CHINA AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

To date, there are no effective vaccines or drugs for the control of neosporosis in animals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Neospora attenuated strain with double deletion of grx S16 and grx C5 genes and its construction method and application
  • Neospora attenuated strain with double deletion of grx S16 and grx C5 genes and its construction method and application
  • Neospora attenuated strain with double deletion of grx S16 and grx C5 genes and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Construction of Neospora Δgrx S16Δgrx C5 strain

[0033] (1) Basic strain Nc1: The Nc1 strain is an international standard strain with glutaredoxin S16 and glutaredoxin C5 genes, the nucleotide sequences of the glutaredoxin S16 and glutaredoxin C5 genes are sequentially are SEQ ID NO.1 and SEQ ID NO.2.

[0034] (2) Construction of pSAG1-Cas9-NcU6-sggrx S16 plasmid

[0035] The specific steps of pSAG1-Cas9-NcU6-sggrx S16 plasmid construction are as follows:

[0036] ①Using the EuPaGDT library in ToxoDB to design a target site for glutaredoxin S16 gene knockout, and design primers according to the target sequence to amplify the Cas9 fragment (fragment 1) and the Neospora U6 promoter (fragment 2). ), T carrier fragment (fragment No. 3), add grx S16-specific gRNA to the U6 promoter downstream primer and the upstream primer of the T carrier backbone, see the plasmid map figure 1 .

[0037] Fragment No. 1 primer (5'→3'):

[0038] F: ATACGACTCACTATAGGGGCG (SE...

Embodiment 2

[0151] Example 2: Characteristics of the Neospora Δgrx S16Δgrx C5 strain

[0152] (1) In vitro invasion and reproduction characteristics of Δgrx S16Δgrx C5 strain

[0153] Plaque assay can comprehensively reflect the invasion, proliferation and situation of Neospora, and the plaque area can directly reflect the invasion and reproduction ability of the parasite. HFFs cells were covered with 12-well cell culture plates, tachyzoites of Δgrx S16Δgrx C5 and Nc1 strains were collected, and then 300 tachyzoites were inoculated into HFF cells, cultured for 7 days, fixed in 4% paraformaldehyde at room temperature for 30 min, and washed with PBS , and stained with crystal violet. After 20 min of staining at room temperature, the residual crystal violet was washed away with PBS, and the plaque area was counted. The results showed that the plaque area of ​​the Δgrx S16Δgrx C5 and Nc1 strains was significantly different (p>0.05), indicating that the invasion and proliferation ability of t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a Neospora attenuated strain with double deletion of grx S16 and grx C5 genes, and a construction method and application thereof. This strain is missing the glutaredoxin S16 gene (grx S16) and the glutaredoxin C5 gene (grx C5) of Neospora. The nucleotide sequences of the grx S16 gene and the grx C5 gene are shown in SEQ ID NO.1, respectively. and SEQ ID NO.2. The reproductive capacity and virulence of the Neospora grx S16 and grx C5 double gene deletion strains constructed by the present invention are significantly reduced, and can effectively resist the re-infection of Neospora after inoculating mice, and has the ability to become a Neospora attenuated vaccine. potential.

Description

technical field [0001] The present invention relates to the field of genetic engineering, in particular to a Neospora attenuated strain with double deletion of grx S16 and grx C5 genes and a construction method and application thereof. Background technique [0002] Neospora is an obligate intracellular parasitic protozoa. Neospora is a parasitic disease common to many animals and is widespread worldwide. The damage to cattle and dogs is particularly serious, mainly causing abortion, stillbirth and nervous system dysfunction in newborn animals. Neospora infection is one of the important reasons for abortion in dairy cattle. So far, there is no effective vaccine or drug for the control of animal neosporosis. At present, the most effective prevention and control measures against neosporosis are to eliminate infected cattle and purify the herd on the basis of effective detection. Therefore, it is of great significance to construct a promising Neospora attenuated vaccine. [0...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/11C12N15/85C12N15/66C12Q1/6893A61K39/002A61P33/02C12R1/90
CPCC12N9/0004C12Y120/04001C12N15/85C12N15/66C12Q1/6893A61K39/002A61P33/02C12Q2600/124A61K2039/552
Inventor 刘群宋星桔刘晶王臣荣许建海
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap