Corynebacterium and colibacillus double expression vector with high copy capability and building method thereof
A technology of coryneform bacteria and Escherichia coli, applied in the biological field, can solve problems such as low copying ability, high cost, and difficulty in large-scale production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] A method for constructing a double expression vector of coryneform bacteria and escherichia coli with high copy capacity, comprising the following steps:
[0042] (1) Using the plasmid pXMJ19 (gifted by Bai Zhonghu Laboratory of Jiangnan University) as a template, the plasmid structure diagram is attached figure 1 As shown, primers were designed to amplify DNA fragment 1 with a length of 2283 bp and DNA fragment 2 with a length of 4348 bp to mutate the nucleotide C at the 1786th position of plasmid pXMJ19 to T by PCR amplification;
[0043] The nucleotide sequences of the primers are as follows:
[0044] Construction of DNA fragment 1 primers:
[0045] C1786T-F: gtttctacaaactcttttgtttatttttctaaatac (SEQ ID NO: 1)
[0046] C1786T-R: agttagtagctcgcacggg (SEQ ID NO: 2)
[0047] Construct DNA fragment 2 primers:
[0048] V-C1786T-F: tgcgagctactaactcatatgcacg (SEQ ID NO: 3)
[0049] V-C1786T-R: gaattcgagctcggtacccgg (SEQ ID NO: 4)
[0050] The PCR reaction system is sh...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com