A kind of anti-human neurofilament light chain (nefl) monoclonal antibody and its application
A monoclonal antibody, human nerve technology, applied in anti-animal/human immunoglobulin, microorganism-based methods, instruments, etc., can solve the problem of no detection reagent registration
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Embodiment 1: the preparation of anti-NEFL monoclonal antibody
[0023] 1. Production of NEFL recombinant protein
[0024] The NEFL gene NM_006158 was selected from Genebank, and the gene encodes 543 amino acids (aa) in full length of NEFL, located at 355-1986nt. The immunogen of the antibody of the present invention is NEFL1-360aa, located at 355-1432nt. Known technical methods clone the gene into pET23a expression plasmid with his tag at the C-terminal, express in BL21 Escherichia coli, purify with nickel column, and identify the purity by SDS-PAGE electrophoresis. After electrophoresis, the target protein band with a molecular weight of about 43kDa was observed on the gel, and the purity was above 90%, which met the purity requirement for the preparation of monoclonal antibody.
[0025] 2. Animal immunity
[0026] The above-mentioned purified NEFL recombinant protein was emulsified with complete Freund's adjuvant, and immunized 6-8 week-old BALB / c mice by subcutane...
Embodiment 2
[0029] Embodiment 2: the identification of anti-NEFL monoclonal antibody
[0030] Through Example 1, 4 monoclonal antibody strains were obtained, namely OTI3G2, OTI11F6, OTI2F5, OTI11F8, and were identified as follows.
[0031] 1. Specific identification of monoclonal antibodies
[0032] It was detected by indirect ELISA method. Coat the microtiter plate with proteins such as the lysate of NEFL, NEFM, NEFH, GFAP, UCH-L1, BSA, PET23a empty plasmid transfection E. coli, PCMV6 plasmid transfection 293 cell lysate, the concentration is 5 μg / ml, 4 ℃ overnight, Block the plate with PBST containing 1% BSA, add 10 4 Two-fold diluted purified antibody, reacted at 37°C for 50min, washed the plate three times with PBST, and added HRP-labeled goat anti-mouse secondary antibody.
[0033]The results showed that the lysates of NEFM, NEFH, GFAP, UCH-L1, BSA, PET23a empty plasmids transferred to Escherichia coli, and the lysates of PCMV6 plasmids transferred to 293 cells were all negative f...
Embodiment 3
[0043] Embodiment 3: gene sequencing and analysis of the variable region of monoclonal antibody
[0044] Procured from Takara Bio USA RACE 5' / 3' kit, using 5'RACE (Rapid Amplification of cDNA Ends, rapid amplification of cDNA ends) technology to clone the variable region sequence of functional antibody from the hybridoma cell line OTI11F6 secreting anti-NEFL monoclonal antibody. The specific experimental process is as follows, see Takara Bio USA company RACE 5’ / 3’Kit User Manual.
[0045] According to the IgG1 subtype of the antibody OTI11F6, specific gene primers pRace-H-GSP and pRace-K-GSP were designed for the 3' ends of its Ig and Kapa constant regions, and the primer sequences were as follows:
[0046] pRace-H-GSP:CATCDGTCTATCCACTGGCCCCTG
[0047] pRace-K-GSP:CTTCCCACCATCCAGTGAGCAGTT
[0048] The DNA fragments of the light and heavy chains of the antibody were amplified by RACE PCR, and the results are shown in figure 1 ,From figure 1 It can be seen that the DNA f...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com