Method for quickly detecting zucchini yellow mosaic virus of siraitia grosvenorii

A technology of small zucchini and mosaic virus, which is applied in the direction of microbe-based methods, biochemical equipment and methods, and microbiological determination/inspection, and can solve the problems of complex operation of molecular hybridization technology, unreasonable primer design, and insufficient sensitivity of detection, etc. , to achieve the effect of increasing the risk of transmission, short detection cycle and good repeatability

Pending Publication Date: 2019-12-10
GUILIN NATURAL INGREDIENTS CORP
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, gene chip technology and molecular hybridization technology are complicated to operate and costly. Although RT-PCR technology has been reported, due to unreasonable primer design, the detection is not sensitive enough, the result is unreliable, and false positives occur.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly detecting zucchini yellow mosaic virus of siraitia grosvenorii
  • Method for quickly detecting zucchini yellow mosaic virus of siraitia grosvenorii
  • Method for quickly detecting zucchini yellow mosaic virus of siraitia grosvenorii

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] 1) Design of detection primers

[0048] The detection primers were designed according to the conserved region of the nucleotide sequence of the ZYMV coat protein gene in GenBank, the forward primer zv1: CATGCCGAGGTATGGTTTGCTTCG, the reverse primer zv2: ACATCACGTGCAGTGTGCCGTTCA, the length of the expected specific product is 222bp.

[0049] 2) Extraction of total RNA from Luo Han Guo seedlings

[0050]Weigh 0.1g leaves and place them in a mortar, grind them into powder under liquid nitrogen, and quickly transfer them to a pre-cooled 1.5mL EP tube; add 600μL TrizoL lysate, mix quickly, and let stand at room temperature for 10min; add 200μL chloroform, quickly Mix well, place at room temperature for 10mim; 4°C, 10000rpm, 15min; transfer the supernatant to a new RNase-free EP tube, add isopropanol 0.6 times the volume of the supernatant, mix gently, and place at room temperature for 15min; Centrifuge at 12,000 rpm for 10 min at 4°C; discard the supernatant and wash twice w...

Embodiment 2

[0058] 1) Design of detection primers

[0059] The detection primers were designed according to the conserved region of the nucleotide sequence of the ZYMV coat protein gene in GenBank, the forward primer zv3: ATACATGCCGAGGTATGGTTTGCTTCG, the reverse primer zv4: GCAGTGTGCCGTTCAGTGTCTTCG, the length of the expected specific product is 216bp.

[0060] 2) Extraction of total RNA from Luo Han Guo seedlings

[0061] Weigh 0.1g leaves and place them in a mortar, grind them into powder under liquid nitrogen, and quickly transfer them to a pre-cooled 1.5mL EP tube; add 600μL TrizoL lysate, mix quickly, and let stand at room temperature for 10min; add 200μL chloroform, quickly Mix well, place at room temperature for 10mim; 4°C, 10000rpm, 15min; transfer the supernatant to a new RNase-free EP tube, add isopropanol 0.6 times the volume of the supernatant, mix gently, and place at room temperature for 15min; Centrifuge at 12,000 rpm for 10 min at 4°C; discard the supernatant and wash twi...

Embodiment 3

[0069] 1) Design of detection primers

[0070] The detection primers were designed according to the conserved region of the ZYMV coat protein gene nucleotide sequence in GenBank, the forward primer zv5: CATGCCGAGGTATGGTTTGCTTC, the reverse primer zv6: GCAGTGTGCCGTTCAGTGTCTTC, the length of the expected specific product was 213bp.

[0071] 2) Extraction of total RNA from Luo Han Guo seedlings

[0072] Weigh 0.1g leaves and place them in a mortar, grind them into powder under liquid nitrogen, and quickly transfer them to a pre-cooled 1.5mL EP tube; add 600μL TrizoL lysate, mix quickly, and let stand at room temperature for 10min; add 200μL chloroform, quickly Mix well, place at room temperature for 10mim; 4°C, 10000rpm, 15min; transfer the supernatant to a new RNase-free EP tube, add isopropanol 0.6 times the volume of the supernatant, mix gently, and place at room temperature for 15min; Centrifuge at 12,000 rpm for 10 min at 4°C; discard the supernatant and wash twice with 75%...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for quickly detecting a zucchini yellow mosaic virus on siraitia grosvenorii. The method comprises the steps of (1) detecting the design of a primer; (2) performing extraction to obtain total RNA of the siraitia grosvenorii to be detected; (3) synthetizing a first chain cDNA; (4) performing PCR through a specific primer pair to obtain an amplification product; and(5) judging whether the siraitia grosvenorii is infected with the zucchini yellow mosaic virus or not according to the length of a target fragment of the amplification product. According to the method disclosed by the invention, a new primer pair different from previous primer pairs is designed in the most conservative region of the zucchini yellow mosaic virus on the siraitia grosvenorii, variation regions of some variants are avoided, and expected products are high in specificity, high in sensibility, good in repeatability, and zero in false positive possibility and false negative possibility. The method is used for monitoring early risk of transmission of the zucchini yellow mosaic virus in siraitia grosvenorii planting regions, and is suitable for quick detection of the zucchini yellow mosaic virus on the siraitia grosvenorii at each stage.

Description

technical field [0001] The invention relates to the field of plant virus detection, in particular to a method for rapidly detecting the yellow mosaic virus of grosvenor squash and zucchini. Background technique [0002] Luo Han Guo (Siraitia grosvenorii) is a cucurbit crop unique to Guangxi. It has precious medicinal and sweetener functions. Because of its medicinal and edible functions, Luo Han Guo is widely welcomed at home and abroad. The increasing market demand promotes the enthusiasm of farmers to plant Luo Han Guo, which makes the planting area of ​​Luo Han Guo increase rapidly. The types of diseases and insect pests of Luo Han Guo are also increasing with the rapid growth of the planting area of ​​Luo Han Guo, and the degree of impact on yield and quality is also increasing. Big. Luo Han Guo virus disease is one of the important diseases of Luo Han Guo. Its serious occurrence not only affects the yield of Luo Han Guo, but also affects the quality of Luo Han Guo, gre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/94
CPCC12Q1/701C12Q1/686
Inventor 张玉华兰玉莫雪燕
Owner GUILIN NATURAL INGREDIENTS CORP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap