Method for positioning and synthesizing terpenoids by means of Yarrowia lipolytica way
A technology for Yarrowia lipolytica and terpenoid compounds, which is applied in the fields of microbial technology and fermentation engineering, can solve problems such as low theoretical yield, and achieve the effects of reducing environmental pollution, increasing yield, and increasing application added value.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Construction of Yarrowia lipolytica Engineering Strain MP1 Positioning and Expressing Mevalonate Synthetic Pathway in Peroxisomes
[0040] 1.1 Construction of expression vector
[0041] (1) Before the stop codon of the HMGR gene (AM902716.1) from Bordetella, an enhanced peroxisome localization signal ePTS1 (nine amino acid sequence of LGRGRSKL at the carboxyl end of the protein) sequence was added, and the gene HMGR was named - ePTS1 (SEQ No.1), synthesized by General Biosystems (Anhui) Co., Ltd. after codon optimization. And at the same time design primers according to the expression vector pKi-1 sequence:
[0042] HMGR-ePTS1-F:
[0043] ATAAGAATCATTCAAAGGTTATGTCTACCGACGCCAAGAA
[0044] HMGR-ePTS1-R:
[0045] ACATAACTAATTACATGATTTTTACAGCTTGGATCGTCGTC
[0046] Using the codon-optimized HMGR-ePTS1 gene sequence as a template, use HMGR-ePTS1-F / HMGR-ePTS1-R primer PCR (polymerase chain reaction) to amplify the HMGR-ePTS1 assembly fragment carrying the corres...
Embodiment 2
[0082] Example 2 Construction of the Yarrowia lipolytica control engineering strain M1 expressing the mevalonate pathway in the cytoplasm
[0083] 2.1 Construction of expression vector
[0084] (1) Design primers according to the gene sequence of optimized and synthesized HMGR-ePTS1 and at the same time according to the expression vector pKi-1 sequence:
[0085] HMGR-F:
[0086] ATAAGAATCATTCAAAGGTTATGTCTACCGACGCCAAGAA
[0087] HMGR-R:
[0088] ACATAACTAATTACATGATTTTAGCCCTGACCTCGGAGTCGAG
[0089] Using the HMGR-ePTS1 gene sequence synthesized by codon optimization as a template, HMGR-F / HMGR-R primers were used to amplify by PCR (polymerase chain reaction) to obtain HMGR assembly fragments carrying corresponding terminal homologous sequences. PCR reaction conditions: pre-denaturation at 97°C for 5min, denaturation at 94°C for 60s, annealing at 56°C for 30s, extension at 72°C for 3min, extension at 72°C for 10min after 30 cycles, and storage at 4°C.
[0090] After pKi-1 was...
Embodiment 3
[0113] Example 3 The comparison of engineering strain MP1 and M1 producing mevalonate efficiency
[0114]Engineering strains: Yarrowia lipolytica (Yarrowia lipolytica) engineering bacteria M1, MP1.
[0115] Yarrowia lipolytica M1 and MP1 stored in frozen glycerol tubes were respectively streaked and inoculated on YPG solid plates, and cultured at 30°C for 30 hours.
[0116] Insert the M1 and MP1 colonies grown on the YPG solid plate into 250mL Erlenmeyer flasks containing 50ml of YPD liquid medium (peptone 20g / L, yeast powder 10g / L, glucose 20g / L), 30°C, 220rpm Shake the culture at rotational speed to activate it.
[0117] Seed culture: Transfer 1ml of activated culture solution to 250mL Erlenmeyer flask containing 50mL seed medium (peptone 20g / L, yeast powder 10g / L, glucose 20g / L) and cultivate aerobically at 220rpm for 24h at 30°C .
[0118] Fermentation culture: Take 2mL of activated culture solution and transfer to 50mL fermentation YPD medium (peptone 20g / L, yeast powd...
PUM
Property | Measurement | Unit |
---|---|---|
pore size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com