Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A host factor hprdx5 with anti-tumor effect, its coding gene and its application

A factor and host technology, applied in anti-tumor drugs, applications, genetic engineering, etc., can solve the problems of poor repeatability, lengthy acquisition cycle, and low quality controllability.

Active Publication Date: 2020-11-13
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, ACBPs exists in the form of a mixture, which has the problems of poor repeatability, low quality controllability, and long acquisition cycle, and because of the source of immunogenicity, it has great limitations in the application of anti-tumor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A host factor hprdx5 with anti-tumor effect, its coding gene and its application
  • A host factor hprdx5 with anti-tumor effect, its coding gene and its application
  • A host factor hprdx5 with anti-tumor effect, its coding gene and its application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0032] The invention provides a method for preparing the host factor hPRDX5, comprising the following steps:

[0033] 1) using the gene as a template, using the primer pair to perform PCR reaction amplification to obtain a DNA fragment with a double restriction site;

[0034] 2) Carrying out double digestion with EcoRI and HindIII respectively on the DNA fragment and the carrier with double restriction sites, and connecting the obtained DNA fragment and the carrier to obtain a recombinant vector;

[0035] 3) introducing the recombinant vector into a prokaryotic expression vector, culturing, inducing, separating and purifying to obtain the recombinantly expressed host factor hPRDX5.

[0036] In the present invention, the amplification system of the PCR reaction is preferably 2×PCR mix 10 μL, ddH 2 O 8 μL, 50-200 ng / μL DNA template 1 μL, 20 μmol / L forward primer 0.5 μL and 20 μmol / L reverse primer 0.5 μL.

[0037] In the present invention, the amplification program of the PCR ...

Embodiment 1

[0050] Amplification primers hPRDX5-forward primer and hPRDX5-reverse primer were designed according to hPRDX5 sequence. The DNA template used for the amplification is a codon-optimized DNA sequence (SEQ ID No. 2), and the PCR amplification is for introducing the required enzyme cutting site.

[0051] The primer sequences are as follows:

[0052] hPRDX5-forward primer: ggaattcatggctccgatcaaagttggtgacg (SEQ ID No. 3);

[0053] hPRDX5 - reverse primer cccaagcttttacagctgagagatgatgttcgga (SEQ ID No. 4).

[0054] The PCR amplification system is: 2×PCRmix 10μl, ddH 2 O 8 μl, template DNA 1 μl (about 50ng-200ng), 20 μM forward and reverse primers 0.5 μl each. The PCR reaction conditions were: 96°C, 2min pre-denaturation; 96°C, 1min denaturation, 56°C, 30s annealing, 72°C extension 40s (30 cycles); finally 72°C extension 5min, 4°C storage.

Embodiment 2

[0056] Construction method of recombinant plasmid expressing protein hPRDX5

[0057] After the PCR amplification in Example 1 is completed, first use 1% agarose gel for electrophoresis, and the voltage is 120 volts. After tapping the gel, use the gel recovery kit (Beijing Kangwei Century Biotechnology Co., Ltd.) to recover about 480bp. The DNA fragment was then digested with EcoRI and HindIII, and the obtained DNA fragment was ligated with the vector pET28a(+), and then the ligated product was transformed into Escherichia coli DH5a competent cells, in LB containing kanamycin antibiotic Screened on the plate.

[0058] Recombinants were verified by double digestion with restriction endonucleases EcoRI and HindIII. The digested products were subjected to agarose gel electrophoresis at a voltage of 120 volts, and the fragment sizes were verified to be about 480 bp fragments and about 5300 bp vectors.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a host factor hPRDX5 with an anti-tumor effect, an encoding gene and application of the host factor, and belongs to the technical field of cancer treatment. The host factor hPRDX5 is a single protein component, has the advantages of good preparation repeatability and controllable quality, does not generate immunogenicity when applied to humans and has incomparable advantagescompared with ACBPs. The host gene hPRDX5 can significantly inhibit growth of in-situ pancreatic cancer tumors, and by studying the adjustment and control effects of the hPRDX5 on CD4, CD8, NKT and MDSCs cells in a tumor immunity micro-environment of a pancreatic cancer mouse, it is discovered that compared with a control group, the proportion of CD4+T, CD8+T and NKT cells in pancreatic tumor tissue is significantly increased after treatment by the hPRDX5. Therefore through application of the host factor hPRDX5 in preparation of anti-tumor drugs, the tumor load can be effectively reduced, andthe period of survival with tumors is prolonged.

Description

technical field [0001] The invention belongs to the technical field of cancer treatment, and in particular relates to a host factor hPRDX5 with anti-tumor effect, encoding gene and application thereof. Background technique [0002] Pancreatic cancer is the king of all cancers. Worldwide statistics show that the incidence and mortality of pancreatic cancer are increasing year by year. Due to the special anatomical part of the pancreas, the early symptoms of pancreatic cancer are hidden, lack of specificity, and difficult to diagnose. Moreover, pancreatic cancer has a high degree of malignancy, rapid progression, and early metastasis. Therefore, when patients are diagnosed, they often have entered the advanced stage of cancer. The 5-year survival rate of patients with pancreatic cancer is less than 5%, and the prognosis is poor. In addition to surgical treatment, chemotherapy is the main treatment for patients with unresectable advanced pancreatic cancer. Traditional chemot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/47C12N15/12C12N15/70C12N1/21A61K38/17A61P35/00
CPCA61K38/00A61P35/00C07K14/47C12N15/70
Inventor 杨兆勇金媛媛邹森樊帅冯晓吕广新王终博张琦
Owner MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com