Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Porcine circovirus type 2 double antibody sandwich ELISA reagent kit and application thereof

A porcine circovirus and double antibody sandwich technology, applied in the biological field, can solve the problems of unverified sensitivity, poor specificity, poor sensitivity, etc., and achieve the effects of short detection period, strong specificity and low production cost

Inactive Publication Date: 2019-05-24
TIANJIN RINGPU BIO TECH
View PDF13 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] CN104749361A and CN103033622A respectively disclose a porcine circovirus type 2 antigen capture Elisa kit, a porcine circovirus type 2 antigen Elisa detection kit and their preparation methods and applications, all based on anti-porcine circovirus type 2 polyclonal antibodies and Anti-porcine circovirus type 2 CAP protein monoclonal antibody is used as capture antibody and detection antibody respectively, the method has poor specificity and high background value
The sensitivity of this method is poor, and the qualitative judgment of negative and positive can only be made based on the color depth of the detection hole. In addition, the cost of using two monoclonal antibodies is relatively high
[0006] CN107037212A discloses a kind of porcine circovirus type 2 antigen quantitative detection kit, the detection antibody of the kit is obtained after the coated antibody is carried out enzyme labeling, adopts the same monoclonal antibody as capture antibody and detection antibody, its sensitivity remains to be seen research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine circovirus type 2 double antibody sandwich ELISA reagent kit and application thereof
  • Porcine circovirus type 2 double antibody sandwich ELISA reagent kit and application thereof
  • Porcine circovirus type 2 double antibody sandwich ELISA reagent kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The preparation of embodiment 1 anti-PCV2 Cap monoclonal antibody

[0050] Using the ORF2 gene sequence of PCV2b ZJ strain as a template (accession number: HM776453.1), the following primers were designed:

[0051] P1: TCACTTAGGGTTAAGTGGGGG (SEQ ID No. 1)

[0052] P2: ACGTATCCAAGGAGGCGTTT (SEQ ID No. 2)

[0053] Using the PCV2b strain sequence as a template, using P1 and P2 as primers, amplify the PCV2 ORF2 gene (the amplified sequence is SEQ ID No.3), and simultaneously cut the gene and the PMD-18T vector with BamHI and XhoI, and connect with T7 Enzyme ligation to obtain the recombinant plasmid PMD-18T-ORF2. Then, the recombinant plasmid was transferred into the expression system of Escherichia coli by thermal transformation method, and the recombinant expression strain pGEX-4T-1-CAP / BL21 was constructed.

[0054] During the fermentation and culture process of recombinant bacteria expressing the target protein, IPTG was used as an inducer, and the fermentation broth...

Embodiment 2

[0056] The preparation of embodiment 2 porcine anti-PCV2 polyclonal antibody

[0057] 2 piglets were tested by PCR and serum antibody, and it was confirmed that they were not infected with PCV2. They were reared separately, with one as the control group and one as the experimental group. The PCV2 virulent strain was used for infection, blood was collected after 7 days, 14 days and 21 days after infection, and serum was collected. Porcine circovirus 2-dCap-Elisa antibody detection kit (Rip (Baoding) Bio-Pharmaceutical Co., Ltd.) was used for antibody detection. For detailed steps, refer to the instructions. The results showed that piglets could produce specific antibodies 7 days after PCV2 infection, and the S / P value was >0.25, which could be used as a standard positive serum; while the serum antibody S / P<0.16 of the uninfected control pigs was negative.

Embodiment 3

[0058] Example 3 Purification of Monoclonal Antibody and Polyclonal Antibody

[0059] 1 Materials and methods

[0060] 1.1 Experimental materials

[0061] 0.06M sodium acetate-acetic acid buffer (PH5.0), 0.01M HAC, 1M NaOH, saturated (NH4)2SO4, PBS (0.01M, PH=7.4), dialysis bag (Biotopped, molecular weight cut off 8000-14000) , caprylic acid, PH meter.

[0062] 1.2 Experimental method

[0063] The anti-PCV2 polyanti-pig serum was centrifuged at 3000rpm for 10min, and the supernatant was aspirated. Add acetate buffer (0.06M, pH=5.0) at a ratio of 1:2, stir while adding, and adjust to pH=4.5 with 0.01mol / L HAC. Add octanoic acid while stirring (75 μl octanoic acid per ml of serum), continue stirring for 30 min, and stand at 4°C for 2 h. Centrifuge at 12,000 rpm at 4°C for 30 minutes, discard the precipitate; adjust the pH of the supernatant to 7.4 with 1M NaOH. While stirring, add saturated (NH4)2SO4 placed at 4°C to make the concentration reach 45%, continue to stir for 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a porcine circovirus type 2 double antibody sandwich ELISA reagent kit and a detection method. The reagent kit includes an enzyme label plate coated with a monoclonal antibodyagainst a porcine circovirus Cap protein, a blocking buffer, a primary antibody, an enzyme-labeled secondary antibody, concentrated washing liquid, a colored solution, a stopping solution, a standard, a positive contrast, and a negative contrast. The porcine circovirus type 2 double antibody sandwich ELISA has the advantages of short detection cycle, simple operation, high sensitivity, strong specificity and simple equipment requirements and can perform qualitative, semi qualitative and quantitative analysis. Moreover, the reagent kit can achieve rapid detection of large quantities of samples. The invention also provides an application of the reagent kit in detecting an antigen of a porcine circovirus type 2 inactivated vaccine.

Description

technical field [0001] The invention belongs to the field of biotechnology. The invention relates to an antigen detection kit, in particular to a porcine circovirus type 2 antigen double-antibody sandwich Elisa detection kit and its application. Background technique [0002] Porcine circovirus type 2 (PCV2) is a single-stranded circular DNA virus belonging to the family Circoviridae, which mainly causes multisystemic wasting syndrome in post-weaning piglets. Once infected with the disease, the body will be immunosuppressed and the resistance will drop, which will easily induce other diseases and seriously endanger the pig industry. PCV2 mainly has two large open reading frames, ORF1 and ORF2. ORF1 is mainly involved in the replication and transcription of the virus, and ORF2 is the main structural protein gene of the virus, encoding the main structural protein Cap protein. Cap protein is related to the immune response of the host, and there is no antigenic cross-reaction ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68
Inventor 李守军张英吕茂杰董瑞凯郁宏伟张桂红厚华艳
Owner TIANJIN RINGPU BIO TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com