Long non-coding RNA and application of long non-coding RNA in diagnosis of preeclampsia and preparation of target drug for curing preeclampsia
A preeclampsia, non-coding technology, applied in the field of genetic engineering, can solve the problems of unclear molecular mechanism, unclear pathogenesis, lack of effective and effective measures, etc., and achieve the effect of high transfection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Detection of the expression of Linc00284 in placental tissue
[0054]Take 0.1g tissue, grind it sufficiently with liquid nitrogen (into a powder form) or discard the culture medium for 1-5×107 cells, and rinse twice with pre-cooled PBS. Add 1ml of Trizol lysate, pipette and mix with an enzyme-free pipette tip, let stand for 5min, and transfer the lysate into a pre-labeled 1.5ml enzyme-free centrifuge tube. Centrifuge at 7500g at 4°C for 5 minutes, take the supernatant and add 1 / 5 volume of chloroform, invert and mix for 30 seconds, and let stand for 2 minutes. Centrifuge at 12000g for 15min at 4°C. Transfer the aqueous layer to a new 1.5ml centrifuge tube. Add an equal volume of isopropanol, mix gently by inversion, and let stand for 5-10min. Centrifuge at 12000g for 10min at 4°C. Discard the supernatant, add 1ml of 75% ethanol (prepared now), and wash the RNA pellet. Centrifuge at 7500g at 4°C for 5min, discard the supernatant. Try to remove 75% alcohol and dry i...
Embodiment 2
[0069] To study the effect of Linc00284 on the function of HTR-8 / SVneo cells.
[0070] First, the normal trophoblast HTR-8 / SVneo cell line was selected as the research object of this experiment, and lip2000 was used as the transfection reagent carrier to transfect the Linc00284 interference sequence si-Linc00284 1#GAGAAAUAGUCUGUGUUGCCCUGA to effectively knock down the expression of Linc00284, and the MTT assay It was found that knockdown of Linc00284 expression in HTR-8 / SVneo cells promoted cell growth. ( figure 2 A). In addition, overexpression of Linc00284 inhibited the growth of HTR-8 / SVneo cells ( figure 2 B). Thus, these data indicate that Linc00284 can inhibit the proliferation ability of HTR-8 / SVneo cells.
Embodiment 3
[0072] Effect of Linc00284 on trophoblast apoptosis
[0073] Flow cytometry Annexin V / PI double staining method to measure cell apoptosis: In order to study whether Linc00284 affects the proliferation of HTR-8 / SVneo cell cycle transition, the normal trophoblast HTR-8 / SVneo cell line was used as the research object. Using Furgern as a vector, the Linc00284 plasmid was transfected to overexpress the expression of Linc00284.
[0074] 1) Cell collection: Suspension cells are directly collected into a 10ml centrifuge tube, while adherent cells are first blown gently with a dropper. Apoptotic cells may detach after being blown, so they are collected into a 10ml centrifuge tube. Cells that do not detach Digest it with 0.02% EDTA to detach it, and the number of cells per sample is (1~5)×10 6 , 500 ~ 1000r / min centrifuge for 5min to discard the culture medium.
[0075] 2) Wash once with incubation buffer, centrifuge at 500-1000r / min for 5min.
[0076] 3) Resuspend the cells with 100...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com