Zyxin gene shRNA inhibiting tumor cell proliferation and migration, recombinant vector and application

A tumor cell proliferation and gene technology, applied in the field of preparation of anti-tumor drugs, can solve the problems of no Zyxin gene proliferation and migration, affecting the treatment effect and prognosis of colorectal cancer patients, etc.

Inactive Publication Date: 2019-04-16
ZHEJIANG UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the application of new molecular targeted drugs and the continuous improvement of treatment options, metastasis is still the key factor affecting the treatment effect and prognosis of patients with colorectal cancer, and is the main cause of death in patients with colorectal cancer
[0007] There is no report on the role of Zyxin gene in the proliferation and migration of intestinal cancer cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Zyxin gene shRNA inhibiting tumor cell proliferation and migration, recombinant vector and application
  • Zyxin gene shRNA inhibiting tumor cell proliferation and migration, recombinant vector and application
  • Zyxin gene shRNA inhibiting tumor cell proliferation and migration, recombinant vector and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Screening and preparation of Zyxin gene efficient interference lentivirus

[0026] The shRNA design for specifically silencing Zyxin (ZYX), construction of expression vectors, lentiviral packaging, and screening and verification of effective strains include the following steps:

[0027] The first step, shRNA fragment sequence design

[0028] According to the human Zyxin gene sequence, three short sequences of Zyxin gene were screened as target sequences, and the corresponding complementary base sequences were designed to form three shRNAs: Zyxin-shRNA1, Zyxin-shRNA2 and Zyxin-shRNA3. The above three shRNA target sequences and their corresponding complementary base sequences are as follows:

[0029] Zyxin-shRNA1 target sequence:

[0030] SEQ ID NO:1 CTTCCACATGAAGTGTTACAA

[0031] Complementary base sequence of Zyxin-shRNA1:

[0032] SEQ ID NO:2TTGTAACACTTCATGTGGAAG

[0033] Zyxin-shRNA2 target sequence:

[0034] SEQ ID NO:4 CTGGGTCACAAACCAAAATCAAA

[0035...

Embodiment 2

[0105] Example 2: Detection of proliferation ability of HCT116 cells stably transfected with lentivirus

[0106] Take the human HCT116 cells infected with the Zyxin-shRNA1 lentivirus provided in Example 1, in a good growth state and in the logarithmic growth phase, and its control, and press 4×10 3 / mL inoculation and 96-well plate, set 5 duplicate wells for each group, place them in an incubator for culture, add 10ul CCK-8 to each well after 24h, 48h, 72h and 96h respectively, mix well and place in culture Continue culturing in the box for 2-4 hours, measure the OD value at a wavelength of 450 nm with a microplate reader, take the average of the experimental results as the final experimental result, and draw the growth curve.

[0107] see attached results image 3 , the results showed that transfection interfered with lentiviral HCT116 cells (attached image 3 After the third day of in vitro culture of HCT116-shZYX) in vitro, the proliferation rate slowed down, which was si...

Embodiment 3

[0108] Embodiment 3: Detection stable transfection interferes with the migration ability of lentivirus HCT116 cells

[0109] Put the Transwell chamber into the culture plate. The chamber is called the upper chamber, and the inside of the culture plate is called the lower chamber. The upper chamber is filled with the culture medium of the upper layer, and the lower chamber is filled with the culture liquid of the lower layer. The upper and lower culture liquids are separated by a polycarbonate membrane. The cells are planted in the upper chamber. Due to the permeability of the polycarbonate membrane, the components in the lower culture medium can affect the cells in the upper chamber, so that the influence of the components in the lower culture medium on cell growth and movement can be studied.

[0110] Take human HCT116 cells infected with Zyxin-shRNA1 lentivirus provided in Example 1, in a good growth state and in logarithmic growth phase, and its control, and adjust the numbe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides Zyxin gene shRNA inhibiting tumor cell proliferation and migration, a recombinant vector and application, and particularly relates to shRNA specifically silencing a Zyxin (ZYX)gene. A silencing vector of the Zyxin gene is constructed. A shRNA fragment is designed first based on the human Zyxin gene sequence, the synthesized fragment has suitable restriction sites at both ends, and the target fragment is connected to a lentiviral vector to form the core silencing vector. The constructed shRNA vector can significantly inhibit the expression of the Zyxin gene at the protein level. Furthermore, a lentivirus is used as a vector carrying shRNA, and the vector can introduce the shRNA sequence directed at the Zyxin gene into colorectal tumor cells in a targeted manner and significantly inhibit the proliferation and migration capability of the colorectal tumor cells.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a shRNA capable of inhibiting the expression of Zyxin gene, thereby inhibiting tumor cell proliferation and migration, in particular to a Zyxin gene shRNA capable of inhibiting tumor cell proliferation and migration and its recombinant carrier, and preparing application in antineoplastic drugs. Background technique [0002] Zyxin (ZYX) gene belongs to LIM protein family, mainly distributed in local adhesion (FA) and able to shuttle between cytoplasm or nucleus. There are three tandem LIM domains at the C-terminus of Zyxin. These three domains interact with many special proteins and are related to local adhesion (Schmeichel, K.L., & Beckerle, M.C. (1994). The LIM domain is a modular protein -binding interface.Cell,79(2),211-219); while the N-terminus is rich in proline, which mediates actin polarization. Zyxin is involved in actin cytoskeleton dynamics, cell movement a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/113C12N15/867A61K31/7088A61P35/00
CPCA61P35/00C12N15/1135C12N15/86C12N2310/14C12N2740/15043C12N2800/107C12N2310/531
Inventor 余捷凯钟晨菡袁瑛房雪峰沈虹郑树
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products