Recombinant human keratinocyte growth factor-1 and preparation and application methods thereof
A technology of recombinant cells and recombinant plasmids, applied in the field of genetic engineering, can solve problems such as differences in activity, and achieve the effects of simple preparation method, good market application prospect and good biological activity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1 Preparation of recombinant protein of the present invention
[0025] 1. Construction of recombinant plasmids
[0026] (1) Synthesis of human keratinocyte growth factor-1 (KGF-1) gene
[0027] gene sequence analysis
[0028] The gene sequence of the KGF-1 coding region (GenBank:) was optimized to obtain the KGF-1 gene sequence (SEQ ID NO: 1) and the expressed amino acid sequence of the KGF-1 gene (SEQ ID NO: 2). Synthesized by Shanghai Sangon Bioengineering Co., Ltd., the synthetic gene sequence was recombined into the plasmid vector pUC57, and the plasmid containing the target gene was obtained as pUC57-KGF-1.
[0029] KGF-1 gene sequence (SEQ ID NO: 1):
[0030] AGCTATGACTACATGGAAGGAGGCGATATCAGAGTGAGAAGACTGTTCTGTCGGACACAGTGGTACCTGAGGATCGACAAGAGAGGCAAGGTGAAGGGCACCCAGGAGATGAAGAATAACTACAACATCATGGAAATCAGGACAGTGGCCGTCGGAATCGTGGCCATCAAAGGAGTGGAAAGTGAATTCTATCTCGCCATGAACAAGGAAGGAAAGCTCTATGCTAAGAAGGAGTGCAATGAAGATTGTAACTTCAAGGAACTCATTCTGGAAAACCATTACAACACATATGCCTC...
Embodiment 2
[0046] Example 2 Detection of biological activity of recombinant human KGF-1 (rhKGF-1) of the present invention
[0047] Take the recombinant human KGF-1 prepared in Example 1 and the commercially available KGF-1, and compare their biological activities:
[0048] 4MBr-5 rhesus macaque lung bronchial epithelial cells were cultured in F-12 medium, and then transferred to 96-well culture plate for further culture. Pre-diluted rhKGF-1 was added for 24 hours to make the final concentration in the range of 1-100ng / mL. The total volume was 100 μL, and the culture was continued for 48 hours in a 37°C constant temperature incubator. After the cultivation, add CCK8 solution, incubate at 37°C for 1.5h, set a multi-function detector to measure absorbance at 450nm, draw a graph and calculate EC50 (half effective concentration for stimulating cell proliferation).
[0049] The test results are shown in the table below. The present invention has the effect of obviously promoting the prolifer...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com