Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Glucose oxidase mutant

A technology of glucose oxidase and mutants, applied in the directions of oxidoreductase, enzymes, biochemical equipment and methods, etc., can solve the problems of inactivation of glucose oxidase, affecting the application effect of glucose oxidase, etc., and achieve the improvement of heat resistance, The effect of broad market prospects

Active Publication Date: 2019-01-15
QINGDAO VLAND BIOTECH GRP
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the short-term high temperature process in the process of feed processing will cause the inactivation of glucose oxidase, which will affect the application effect of glucose oxidase. On the premise that the production of glucose oxidase is guaranteed, the temperature resistance of glucose oxidase has become increasingly popular. Concern, therefore, it is imminent to develop glucose oxidase with strong temperature resistance by genetic engineering

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Synthesis of Glucose Oxidase Mutant GOD11 Gene and Acquisition of Recombinant Plasmid

[0038] In order to improve the heat resistance of glucose oxidase (the amino acid sequence is SEQ ID NO: 1, and its encoding nucleotide sequence is SEQ ID NO: 2), the applicant mutated the 65th and 416th amino acid positions, and the 65th Amino acid at position 416 was changed from A to K.

[0039] The glucose oxidase mutant containing the above two mutation sites was named GOD11, and its sequence was optimized and synthesized by Shanghai Jierui Bioengineering Co., Ltd. according to the coding preference of Pichia pastoris. Its amino acid sequence is SEQ ID NO: 3, and its The coding nucleotide sequence is SEQ ID NO: 4, and EcoRI and NotI restriction sites are respectively added to the 5' and 3' ends of the synthetic sequence.

[0040] The GOD11 gene sequence synthesized above was digested with EcoRI and NotI, then ligated with the pPIC-9K vector after the same digestion at...

Embodiment 2

[0041] Example 2 Screening of heat-resistant mutants

[0042]In order to further improve the heat resistance of the glucose oxidase mutant GOD11, the applicant screened a large number of mutations of the enzyme through directed evolution technology, and designed PCR primers GOD-F1 and GOD-R1 as follows:

[0043] GOD-F1: GGC GAATTC GGTATTGAGGCATCTTTGTTGAC (the underline is the restriction endonuclease EcoRI recognition site)

[0044] GOD-R1: ATA GCGGCCGC TTATTGCATAGAAGCGTAATC (the underline is the restriction endonuclease Not I recognition site)

[0045] Using the GOD11 gene as a template, use the above primers to perform PCR amplification with the GeneMorph II Random Mutation PCR Kit (Stratagene), recover the PCR product from the gel, perform enzyme digestion with EcoRI and Not I, and then ligate it to the pET21a vector after the same enzyme digestion. Transform into Escherichia coli BL21(DE3), spread on LB+Amp plate, and culture upside down at 37°C. After the transformant...

Embodiment 3

[0049] The construction of embodiment 3 pichia pastoris engineering strain

[0050] The expression plasmids pPIC9K-GOD-11 and pPIC9K-GOD-K were linearized with Sal I respectively, and the linearized fragments of the expression plasmids were transformed into Pichia pastoris GS115 by electroporation, and the recombinant strains of Pichia pastoris were screened on MD medium respectively. GS115 / pPIC9K-GOD-11 and GS115 / pPIC9K-GOD-K were then screened for multi-copy transformants on YPD medium containing different concentrations of geneticin.

[0051] The transformants of the screened mutants were named Pichia pastoris GOD-11 (Pichia pastorisGOD-11) and Pichia pastoris GOD-K (Pichia pastoris GOD-K), respectively, and were transferred to BMGY medium at 30°C , 250rpm shaking culture for 1d; then transfer to BMMY medium, 30°C, 250rpm shaking culture; add 0.5% methanol every day, induce expression for 4d; centrifuge to remove the bacteria, and obtain glucose oxidase mutants GOD11 and GO...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of protein engineering, in particular to a glucose oxidase mutant. The glucose oxidase three-point mutant GOD-K has residual enzyme activity of 68.20% after processing at 70 DGE C for 2.5 min, after treatment at 75 DEG C for 2.5 min, the residual enzyme activity is 42.76%, which are 19.3% and 38.1% higher than that of the two point mutant GOD11, respectively. The results showed that the mutant GOD11 had unexpected effect and was more suitable for application in industrial production, so its market prospect was broad.

Description

technical field [0001] The invention relates to the technical field of protein engineering, in particular to a glucose oxidase mutant and application thereof. Background technique [0002] Glucose oxidase (glucose oxidase, E.C.1.1.3.4, GOD) can specifically catalyze β-D-glucose to generate gluconic acid and hydrogen peroxide under aerobic conditions. Glucose oxidase is a homodimeric molecule containing two flavin adenine dinucleotide (FAD) binding sites. Each monomer contains two completely different domains: one is non-covalently but tightly bound to part of FAD, mainly for acoustic folding; the other binds to the substrate β-D-glucose, and is supported by 4 α-helices for a trans Parallel beta-sheets. [0003] Glucose oxidase is widely distributed in animals, plants and microorganisms. However, the content of glucose oxidase in animal and plant tissues is limited, and microorganisms are widely used as the source of glucose oxidase because of their advantages such as wide...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/04C12N15/53
CPCA23K20/189C12N9/0006C12Y101/03004
Inventor 吴秀秀邵弨王华明
Owner QINGDAO VLAND BIOTECH GRP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com