Glucose oxidase mutant
A technology of glucose oxidase and mutants, applied in the directions of oxidoreductase, enzymes, biochemical equipment and methods, etc., can solve the problems of inactivation of glucose oxidase, affecting the application effect of glucose oxidase, etc., and achieve the improvement of heat resistance, The effect of broad market prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0037] Example 1 Synthesis of Glucose Oxidase Mutant GOD11 Gene and Acquisition of Recombinant Plasmid
[0038] In order to improve the heat resistance of glucose oxidase (the amino acid sequence is SEQ ID NO: 1, and its encoding nucleotide sequence is SEQ ID NO: 2), the applicant mutated the 65th and 416th amino acid positions, and the 65th Amino acid at position 416 was changed from A to K.
[0039] The glucose oxidase mutant containing the above two mutation sites was named GOD11, and its sequence was optimized and synthesized by Shanghai Jierui Bioengineering Co., Ltd. according to the coding preference of Pichia pastoris. Its amino acid sequence is SEQ ID NO: 3, and its The coding nucleotide sequence is SEQ ID NO: 4, and EcoRI and NotI restriction sites are respectively added to the 5' and 3' ends of the synthetic sequence.
[0040] The GOD11 gene sequence synthesized above was digested with EcoRI and NotI, then ligated with the pPIC-9K vector after the same digestion at...
Embodiment 2
[0041] Example 2 Screening of heat-resistant mutants
[0042]In order to further improve the heat resistance of the glucose oxidase mutant GOD11, the applicant screened a large number of mutations of the enzyme through directed evolution technology, and designed PCR primers GOD-F1 and GOD-R1 as follows:
[0043] GOD-F1: GGC GAATTC GGTATTGAGGCATCTTTGTTGAC (the underline is the restriction endonuclease EcoRI recognition site)
[0044] GOD-R1: ATA GCGGCCGC TTATTGCATAGAAGCGTAATC (the underline is the restriction endonuclease Not I recognition site)
[0045] Using the GOD11 gene as a template, use the above primers to perform PCR amplification with the GeneMorph II Random Mutation PCR Kit (Stratagene), recover the PCR product from the gel, perform enzyme digestion with EcoRI and Not I, and then ligate it to the pET21a vector after the same enzyme digestion. Transform into Escherichia coli BL21(DE3), spread on LB+Amp plate, and culture upside down at 37°C. After the transformant...
Embodiment 3
[0049] The construction of embodiment 3 pichia pastoris engineering strain
[0050] The expression plasmids pPIC9K-GOD-11 and pPIC9K-GOD-K were linearized with Sal I respectively, and the linearized fragments of the expression plasmids were transformed into Pichia pastoris GS115 by electroporation, and the recombinant strains of Pichia pastoris were screened on MD medium respectively. GS115 / pPIC9K-GOD-11 and GS115 / pPIC9K-GOD-K were then screened for multi-copy transformants on YPD medium containing different concentrations of geneticin.
[0051] The transformants of the screened mutants were named Pichia pastoris GOD-11 (Pichia pastorisGOD-11) and Pichia pastoris GOD-K (Pichia pastoris GOD-K), respectively, and were transferred to BMGY medium at 30°C , 250rpm shaking culture for 1d; then transfer to BMMY medium, 30°C, 250rpm shaking culture; add 0.5% methanol every day, induce expression for 4d; centrifuge to remove the bacteria, and obtain glucose oxidase mutants GOD11 and GO...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap