A kind of method of highly efficient full degradation polycaprolactone
A polycaprolactone, full-degradation technology, applied in the field of fusion enzyme application, can solve the problems of pollution, slow degradation of polycaprolactone waste, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] The cloning of embodiment 1 gene
[0037] Using the Lip gene sequence (from T.lanuginosus, the nucleotide sequence shown in SEQ ID NO.3) as a template, using primer 5'-AGAGAGGCTGAAGCTGAATTCCGGCCTGTTCGACGAGCGGT-3' and primer 5'-AGGTGGGGTTGGGTGCGCTGCTGGTTGTCGTAGGTCCATCACTCTGAAAT-3' to perform PCR amplification to obtain the fusion The Lip fragment of the enzyme Lip-Cut; using the Cut gene sequence (from T.Terrestris, the nucleotide sequence shown in SEQ ID NO.4) as a template, using primer 5'-ACCCAACCCCACCTCCAGTGGCTGCCCGAATGCCACCAAGGCCCCAACACAGCCA-3' and primer 5'-GAGATGAGTTTTTGTTCTAGAAATCAATGATGATGATGATGATGAGCATCACCAATCTT- Perform PCR amplification at 3' to obtain the Cut fragment containing the linker of the fusion enzyme Lip-Cut; use the Lip fragment and the Cut fragment of the bifunctional fusion enzyme Lip-Cut as templates, use primer 5'-AGAGAGGCTGAAGCTGAATTCCGGCCTGTTCGACGAGCGGT-3' and primer 5'- GAGATGAGTTTTTGTTCTAGAAATCAATGATGATGATGATGATGAGCATCACCAATCTT-3' was ampl...
Embodiment 2
[0039] Embodiment 2 Lip, the expression and purification of Cut and Lip-Cut in P.pastoris KM71H
[0040] The positive clone DH5α with correct sequencing was inoculated into a test tube containing 3 mL of LB liquid medium, and cultured at 37°C with shaking at 200 rpm / min for about 12 hours. The mini-extraction of recombinant expression plasmids pPICZαA-Lip, pPICZαA-Cut and pPICZαA-Lip-Cut was extracted using EasyPure Plasmid MiniPrepKit of Beijing Quanshijin Biotechnology Co., Ltd. Transfer the extracted recombinant expression plasmids pPICZαA-Lip, pPICZαA-Cut and pPICZαA-Lip-Cut into P. pastoris KM71H, coat a plate containing 100 μg / mL Zeocin to screen positive clones, and insert the screened positive clones into Cultivate 100μg / mL Zeocin in 3mL YPD liquid medium on a shaker for 16-18h; inoculate the cultured bacteria solution into 50mL sterilized BMGY medium at a ratio of 1:100-1:50, at 28°C, 200rpm / min Shake culture to OD 600 =6.0-8.0; Centrifuge the bacterial solution at ...
Embodiment 3
[0042] Using the bifunctional fusion enzyme Lip-Cut to degrade PCL, the steps are:
[0043] 1) Weigh 1g of polycaprolactone (PCL) and dissolve it in 100mL of chloroform, and use a magnetic stirrer RH-KT / C to stir the various polyesters evenly for about 12 hours;
[0044] 2) Put the various solutions that are completely dissolved into polytetrafluoroethylene containers and evaporate naturally for later use;
[0045] 3) Peel off the prepared various polymer films from the container, and cut it into about 5×10mm 2 samples, and then dried in a constant temperature drying oven, preserved and set aside;
[0046] 4) Add 1mL pH8.00.05M phosphate buffer (K 2 HPO 4 -KH 2 PO 4 ), various polymer films after accurate weighing, Lip, Cut and Lip-Cut with the same number of molecules (0.869nmol), at the optimum temperature (35℃Lip, 40℃Lip-Cut, 40℃ , 50°C Cut) and 150rpm / min for 48 hours of hydrolysis respectively. During the experiment, samples were taken regularly, and the control gro...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com