Polypeptide nano bubbles as well as preparation method and application thereof
A nanobubble and microbubble technology, applied in the field of polypeptide nanobubble and its preparation, can solve the problems of poor biocompatibility and weak targeting, and achieve the effects of stable properties, significant advantages and improved utilization.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Preparation of polypeptide nanobubble and polypeptide nanobubble-curcumin preparation
[0028] Experimental plasmid: The company purchased the vector plasmid containing the EGFP reporter gene as pIRES2-EGFP, and its map is shown in figure 1 shown.
[0029] Experimental steps:
[0030] 1) Using pIRES2-EGFP as a carrier, construct a recombinant plasmid containing Flag tag, targeting polypeptide CKGGRAKDC and CD63 gene; the detailed steps are as follows:
[0031] 1.1 Primer Design
[0032]Design specific PCR primers according to the CDS sequence of CD63 and the MCS site of the pIRES2-EGFP expression vector: the nucleotide sequence of primer CD63-F is shown in SEQ ID NO: 1, and the nucleotide sequence of primer CD63-R is shown in shown in SEQ ID NO:2. CD63-F contains XhoI restriction site (CTCGAG), Flag tag sequence (GATTACAAGGATGACGACGATAAG) and adipose tissue targeting polypeptide CKGGRAKDC sequence (TGTAAGGGAGGAAGAGCGAAGGATTGT); CD63-R contains EcoRI restri...
Embodiment 2
[0089] Example 2 Polypeptide nanobubble-curcumin formulation can effectively inhibit the weight gain of high-fat-fed mice
[0090] Experimental animals: 6-week-old male mice and feed were provided by the Experimental Animal Center of Nanjing Medical University, license number: SCXK (Su) 2011-0003. Animals were housed in random cages with free water and water.
[0091] Experimental drugs: normal diet control group (blank control group); high-fat diet was divided into normal saline group (model control group), nanobubble group, nanobubble-curcumin group, and polypeptide nanobubble group (step 3 from Example 1) prepared), curcumin group and polypeptide nanobubble-curcumin group (prepared by step 4 of Example 1).
[0092] Among them, the preparation steps of nanobubbles are as follows: inoculate 293T cells (ATCC, product number: CM-H010) into the cell culture medium, place at 37°C, 5% CO 2 Culture in an incubator to a density of 70-90% (approximately 0.25-1 x 10 6 cells), colle...
Embodiment 3
[0098] Example 3 Polypeptide nanobubble-curcumin formulation can significantly inhibit the storage of visceral fat and subcutaneous fat in high-fat-fed mice
[0099] 1) According to the experimental procedure of Example 2, high-fat-fed obese mice were administered intravenously for 20 weeks;
[0100] 2) The mice in each group were fasted for 12 hours, anesthetized by intraperitoneal injection of 3% sodium pentobarbital, 45 mg / kg, and weighed accurately;
[0101] 3) Routine disinfection and laparotomy were performed, and the adipose tissue around the kidney, the adipose tissue around the mesentery, the adipose tissue around the epididymis, and the subcutaneous adipose tissue in the abdomen were quickly removed and weighed for wet weight (among them, the subcutaneous adipose tissue in the abdomen: the abdomen below the costal arch and above the groin) , bounded by the midaxillary line on both sides);
[0102] 4) Calculated according to the following formula, namely: abdominal f...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com