Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Surface plasma resonance technology-based gastrodia elata anti-counterfeiting traceability system and method

A surface plasma and gastrodia elata technology, applied in the field of anti-counterfeiting traceability system of gastrodia elata with ion resonance technology, to achieve the effect of controlling copying and good anti-counterfeiting means

Inactive Publication Date: 2018-10-09
亳州中药材商品交易中心有限公司
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Other logos, such as medicine logos include Chinese herbal medicine logos, prescription drug logos, imported drug logos, special management drug logos, and national essential drug logos, but the codes can be easily copied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Surface plasma resonance technology-based gastrodia elata anti-counterfeiting traceability system and method
  • Surface plasma resonance technology-based gastrodia elata anti-counterfeiting traceability system and method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] To prepare a DNA chip, the specific process is as follows:

[0043] 1. A layer of 150nm metal film is attached to the surface of the silicon chip through a metal coating process, which can be Au or Ag;

[0044] 2. The probe gene fragments are thiolated, and then different thiolated probes are spotted in different regions, and kept at 4°C for 12 hours, wherein the gene probes include the following probes:

[0045] Probe 1: TGATATGCTTAAGTTCAGCGG;

[0046] Probe 2: TCCTACCTGATTTGAGGTCAG;

[0047] Probe 3: TTTGAAGCATGAATCC;

[0048] Probe four: AGATAATTATC;

[0049] Probe five: AGATAATTATCACAC;

[0050] Probe six: GCGTTCAAAGATTCGATGAT;

[0051] 3. Then rinse off the unbound probes on the metal film surface with deionized water, and then blow dry with nitrogen gas.

[0052] The DNA chip prepared by the above method has good stability and can be circulated in the market for a long time with the product. The DNA probe on the surface is designed for the DNA sequence of Ga...

Embodiment 2

[0054] The specific process of constructing the Gastrodia elata DNA database is as follows:

[0055] 1. The gastrodia elata sample was extracted by CTAB method. The specific process is as follows: add 4ml CTAB extract solution and 80ul mercaptoethanol to the centrifuge tube, preheat in a 65±5℃ water bath, take the gastrodia elata sample, grind it into powder with liquid nitrogen, and transfer it into In the preheated centrifuge tube, seal it, keep it in a water bath at 65±5°C for 30±10 minutes, take out the centrifuge tube, quickly cool down to room temperature, and add 4 ml of phenol: chloroform: isoamyl alcohol to a ratio of 25:24:1 Mix the solution and mix well to form a mixed emulsion; centrifuge at 12000r / min for 10min, take the supernatant, add 4ml of chloroform:isoamyl alcohol as a 24:1 mixed solution, mix well and place at room temperature for 10-20min, 12000r Centrifuge at / min for 10 min, remove the supernatant, wash the precipitate with absolute ethanol and 70% etha...

Embodiment 3

[0061] Check the validity of the DNA chip and the Gastrodia elata DNA database, the inspectors do not know the authenticity of the tested Gastrodia elata sample:

[0062] 1. Extract the gastrodia elata sample by the CTAB method. The specific process is as follows: add 4ml CTAB extract solution and 80ul mercaptoethanol to the centrifuge tube, preheat in a 65±5℃ water bath, take the gastrodia elata sample and grind it into powder with liquid nitrogen , transferred to a preheated centrifuge tube, sealed, kept in a water bath at 65 ± 5°C for 30 ± 10 minutes, took out the centrifuge tube, quickly cooled to room temperature, and added 4 ml of phenol: chloroform: isoamyl alcohol to a ratio of 25: 24:1 mixed solution, mix well to form mixed emulsion; centrifuge at 12000r / min for 10 min, take the supernatant, add 4 ml of chloroform:isoamyl alcohol to a 24:1 mixed solution, mix well and place at room temperature for 10- Centrifuge at 12000r / min for 10min for 20min, remove the supernatan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of the gastrodia elata identification and anti-counterfeiting technology, and particularly relates to a surface plasma resonance technology-based gastrodia elata anti-counterfeiting traceability system and a gastrodia elata anti-counterfeiting traceability method. The system comprises a cloud end, a DNA chip, an identification device, a tracing label and a DNA retrieval terminal. The DNA chip and the tracing label are adopted by a tracing and retrieval terminal of a gastrodia elata DNA internet-of-things anti-counterfeiting system, so that the rapid detectioncna be realized through the DNA chip based on the biological detection experiment capability. Meanwhile, the true-false distinguishing function can be realized through the analysis of DNA big data, so that the anti-counterfeiting purpose is realized. For the absence of the biological detection experiment capability, the tracing can be carried out through the tracing label, so that the production,processing, storing, transaction, terminal and detection information of gastrodia elata can be checked. The cloud end is used for analyzing whether the abnormity exists or not, and then sending the analysis result to a querier. Based on big data, the data inquired by the tracing label is changed along with time and the space. Even when the same tracing label is copied, abnormal query conditions can also be found by the system. Therefore, the copying behavior of a counterfeiter is effectively controlled, and a better anti-counterfeiting means is formed.

Description

technical field [0001] The invention belongs to the field of anti-counterfeiting identification of Gastrodia elata, and in particular relates to a system and method for anti-counterfeiting and traceability of Gastrodia elata based on surface plasmon resonance technology. Background technique [0002] Gastrodia elata is the dried tuber of the orchid Gastrodia elata Bl. Also known as Chijian, Li Mu, Ghost Duyou, Shencao, Duyaozhi, Chijianzhi, Dingfengcao, Helicao, Duyao, automatic grass, and water potato. From the beginning of winter to the next year before Qingming, it is a famous Chinese medicinal material. It has been used as medicine more than 2,000 years ago, and the ones produced in Zhaotong, Yunnan are the best. Rich in gastrodin, vanillin, protein, amino acids, and trace elements. Its properties are pungent, warm, non-toxic, anti-epileptic, anti-palpitation, anti-rheumatic; sedative, antispasmodic, analgesic, tonic, and calming the liver and relieving wind. Functio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G06K17/00G06F19/28G06F19/20G01N21/552
CPCG06K17/0022G01N21/553G16B25/00G16B50/00
Inventor 怀化
Owner 亳州中药材商品交易中心有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com