Surface plasma resonance technology-based gastrodia elata anti-counterfeiting traceability system and method
A surface plasma and gastrodia elata technology, applied in the field of anti-counterfeiting traceability system of gastrodia elata with ion resonance technology, to achieve the effect of controlling copying and good anti-counterfeiting means
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] To prepare a DNA chip, the specific process is as follows:
[0043] 1. A layer of 150nm metal film is attached to the surface of the silicon chip through a metal coating process, which can be Au or Ag;
[0044] 2. The probe gene fragments are thiolated, and then different thiolated probes are spotted in different regions, and kept at 4°C for 12 hours, wherein the gene probes include the following probes:
[0045] Probe 1: TGATATGCTTAAGTTCAGCGG;
[0046] Probe 2: TCCTACCTGATTTGAGGTCAG;
[0047] Probe 3: TTTGAAGCATGAATCC;
[0048] Probe four: AGATAATTATC;
[0049] Probe five: AGATAATTATCACAC;
[0050] Probe six: GCGTTCAAAGATTCGATGAT;
[0051] 3. Then rinse off the unbound probes on the metal film surface with deionized water, and then blow dry with nitrogen gas.
[0052] The DNA chip prepared by the above method has good stability and can be circulated in the market for a long time with the product. The DNA probe on the surface is designed for the DNA sequence of Ga...
Embodiment 2
[0054] The specific process of constructing the Gastrodia elata DNA database is as follows:
[0055] 1. The gastrodia elata sample was extracted by CTAB method. The specific process is as follows: add 4ml CTAB extract solution and 80ul mercaptoethanol to the centrifuge tube, preheat in a 65±5℃ water bath, take the gastrodia elata sample, grind it into powder with liquid nitrogen, and transfer it into In the preheated centrifuge tube, seal it, keep it in a water bath at 65±5°C for 30±10 minutes, take out the centrifuge tube, quickly cool down to room temperature, and add 4 ml of phenol: chloroform: isoamyl alcohol to a ratio of 25:24:1 Mix the solution and mix well to form a mixed emulsion; centrifuge at 12000r / min for 10min, take the supernatant, add 4ml of chloroform:isoamyl alcohol as a 24:1 mixed solution, mix well and place at room temperature for 10-20min, 12000r Centrifuge at / min for 10 min, remove the supernatant, wash the precipitate with absolute ethanol and 70% etha...
Embodiment 3
[0061] Check the validity of the DNA chip and the Gastrodia elata DNA database, the inspectors do not know the authenticity of the tested Gastrodia elata sample:
[0062] 1. Extract the gastrodia elata sample by the CTAB method. The specific process is as follows: add 4ml CTAB extract solution and 80ul mercaptoethanol to the centrifuge tube, preheat in a 65±5℃ water bath, take the gastrodia elata sample and grind it into powder with liquid nitrogen , transferred to a preheated centrifuge tube, sealed, kept in a water bath at 65 ± 5°C for 30 ± 10 minutes, took out the centrifuge tube, quickly cooled to room temperature, and added 4 ml of phenol: chloroform: isoamyl alcohol to a ratio of 25: 24:1 mixed solution, mix well to form mixed emulsion; centrifuge at 12000r / min for 10 min, take the supernatant, add 4 ml of chloroform:isoamyl alcohol to a 24:1 mixed solution, mix well and place at room temperature for 10- Centrifuge at 12000r / min for 10min for 20min, remove the supernatan...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com