A kind of alginate lyase sha-6 gene and its application
A technology of alginate lyase and SHA-6, which is applied in the field of microbial genetic engineering and can solve the problems of low expression level and unreported issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Marina catena alginatilytica Preparation and Detection of SH-52 Genomic DNA
[0040] used in the present invention Marina catena alginatilytica SH-52 is a strain screened by our laboratory. The preparation of SH-52 genomic DNA adopts the extraction method of common bacterial genome. The specific content is as follows: Take 2 mL of overnight culture liquid and centrifuge at 4000 rpm for 2 min at 4 ° C. Discard the supernatant and collect the bacteria. To the body, add 100 µL Solution I suspension, 30 µL 10% SDS and 1 µL 20 mg / mL proteinase K, mix well, and incubate at 37°C for 1 h. Add 100 µL of 5M NaCl, invert and mix well, then add 20 µL CTAB / NaCl solution (CTAB 10%, 0.7M NaCl), and incubate at 65°C for 10 min. Add an equal volume of chloroform / isoamyl alcohol (24:1), mix by inverting, and centrifuge at 12,000 rpm for 5 min at 4°C. Take the supernatant, add 2 times the volume of absolute ethanol, 0.1 times the volume of 3M NaAc, place at -20°C for 30 m...
Embodiment 2
[0041] Embodiment 2: the amplification and TA clone of alginate lyase SHA-6 gene
[0042] alginate lyase SHA-6 gene amplification and cloning figure 2 As shown, design a pair of specific primers, the sequence is as follows:
[0043] SHA-6-F : GGATCC ATGCAGAAAAAGTATGTCTCGCT
[0044] SHA-6-R: GCGGCCGC TTAATGAATGATTAATTTGTAG
[0045] The GGATCC characteristic sequence was introduced at the 5' end to form a BamH I restriction site; the GCGGCC characteristic sequence was introduced at the 3' end to form a Not I restriction site.
[0046] Add 10 ng of Marinicatena alginatilytica SH-52 genomic DNA was used as a template, and 50ng of specific primers SHA-6-F and SHA-6-R, 2.5µL of dNTP (10mM), 2.5µL of Pfu reaction buffer and 0.5µL of Pfu (5U / µL) were added to aggregate Enzyme (Beijing Quanshijin Biotechnology Co., Ltd.), add double distilled water to make the final volume 25µL. Heat at 94°C for 3 minutes on the PCR instrument, then perform 25 cycles of reaction according ...
Embodiment 3
[0047] Example 3: Prokaryotic expression vector pET-32a- SHA-6 build
[0048] Such as Figure 4 As shown, the purified prokaryotic expression vectors pET-32a and pMD19-T- SHA-6 , the cut vector and the inserted target fragment were separated by agarose gel electrophoresis, and the vector fragments pET-32a and pMD19-T- SHA-6 produced by cutting SHA-6 The DNA fragment was connected to the pET-32a vector fragment and SHA-6 Prokaryotic expression vector pET-32a- SHA- 6 . Transform the ligation reaction mixture into Escherichia coli competent cells BL21 (Tiangen Biochemical Technology), spread the transformed Escherichia coli on a plate added with ampicillin (final concentration: 100 µg / mL), culture overnight at 37°C, and select Amp Resistant recombinant colonies, using SHA-6-F and SHA-6-R primers for colony PCR verification, after the successful connection of the plasmids for liquid culture, the plasmid DNA was extracted by alkaline lysis, and the recombinant plasmid...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap