Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for expressing duck-sourced avian influenza virus NS1 protein and application of method

An avian influenza virus, PTIEV4-NS1 technology, applied in the field of expression of duck-derived avian influenza virus NS1 protein, can solve the problems of low protein activity, high cost of cultivation, and low secretion efficiency

Active Publication Date: 2018-06-08
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI +1
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The protein expressed by the animal cell expression system has natural biological activity and function, but the operation is cumbersome and the cost of cultivation is high, so it is not suitable for large-scale cultivation
Although yeast cells are easy to operate and have low culture costs, they are difficult to break the wall and have low secretion efficiency, which easily affects the purification of downstream proteins
The protein expressed in Escherichia coli lacks transcriptional and post-translational processing modifications, and the expressed protein activity is not high or has no activity, so it is limited in use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing duck-sourced avian influenza virus NS1 protein and application of method
  • Method for expressing duck-sourced avian influenza virus NS1 protein and application of method
  • Method for expressing duck-sourced avian influenza virus NS1 protein and application of method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0028] 2) Preparation of NS1 gene cDNA: the viral RNA extracted in step 1) is reverse transcribed into cDNA by reverse transcription primer sequence 5'-AGCAAAAGCAGG-3';

[0029] 3) PCR amplification of NS1 gene:

[0030] Using FQNS1F-BamHI and FQNS1R-XhoI as primers, using the cDNA obtained in step 2) as a template, PCR amplifies the NS1 gene; wherein, the sequences of the FQNS1F-BamHI and FQNS1R-XhoI are as follows:

[0031] FQNS1F-BamHI: GGATCC ATGGACTCCAACACTGTGTCAAG, where the underlined part is the BamHI restriction enzyme site;

[0032] FQNS1R-XhoI: CTCGAG TCAGTGATGGTGATGGTGATGTTTATCGTCGTCGTCTTTATAATCCTTTGGAGAGAGTGGAGGTC, where the underlined part is the XhoI restriction enzyme site;

[0033] 4) Construction of TOPO clone positive plasmid and codon optimization: After the PCR amplification product obtained in step 3) was purified and recovered, the online software was used to analyze the codon usage bias of the NS1 gene and Tetrahymena, and then the NS1 gene was cod...

specific Embodiment

[0060] 1.1 Materials

[0061] The duck-origin avian influenza virus A / duck / Fujian / FQ2 / 2007 (H9N2) strain was isolated from Fujian in 2007 by our laboratory (GenBank accession number JF916709). The method of virus isolation is as follows: collect the trachea, lung, and kidney tissues of sick chickens and homogenize them in a sterilized glass grinder, make a suspension of 100 g / L with PBS, freeze and thaw twice, centrifuge at 2500 × g for 10 min, and take The supernatant was filtered and sterilized through a 0.22 μm filter for later use. Inoculate 10-day-old SPF chicken embryos with the treated tissue suspension through the allantoic cavity, incubate at 37°C with 0.2ml each, remove dead chicken embryos within 24 hours, observe twice a day, and collect aseptically for 48-96 hours The allantoic fluid was continuously passed for 3 generations, and the embryo fluid was aseptically recovered and stored at -30°C for future use. Rabbit anti-A / duck / Fujian / FQ2 / 2007 (H9N2) serum and Esc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for expressing duck-sourced avian influenza virus NS1 protein and application of the method. The method comprises the following main steps: (1), constructing a tetrahymena expression vector pD5H8-NS1; (2), constructing and screening a tetrahymena recombinant cell strain; and (3), performing induced expression and identification on the NS1 protein. The method for expressing the duck-sourced avian influenza virus NS1 protein is applied to preparation of an avian influenza virus identifying diagnostic kit and preparation of a vaccine; a tetrahymena expression system is selected as an expression system of the duck-sourced avian influenza virus NS1 protein, and can efficiently and stably express the duck-sourced avian influenza virus NS1 protein; a transgenic expression vector pD5H8 used by the selected tetrahymena cell expression system contains a high-efficiency metallothionein gene MTT5 promoter, so that an important guarantee is provided for efficient expression of a foreign gene in tetrahymenon.

Description

technical field [0001] The invention relates to a method for expressing duck-origin avian influenza virus NS1 protein and application of the method. Background technique [0002] Avian Influenza (Avian Influenza) is an infection and / or disease syndrome of birds (poultry and wild birds) caused by type A influenza virus. The virus consists of 8 gene segments, the shortest of which is a viral non-structural gene (non-structural gene, NS). During virus replication, the NS gene expresses two important functional proteins, namely the 26kDa NS1 protein and the 14kDa NEP (nuclear export protein, NEP) protein. Among them, the NS1 protein is a multifunctional protein with two typical structural domains, namely the RNA-binding domain (RNA-binding domain, RBD) and the effector binding domain (an effector domain, ED), which determine the ability of AIV to be infected. Key determinants of cellular destructiveness, affecting AIV replication, pathogenicity, virulence, and host range. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/79C12N15/44C12N15/66C07K14/11G01N33/569A61K39/145A61P31/16
CPCC07K14/005C12N15/66C12N15/79C12N2760/16122C12N2760/16134C12N2800/22G01N33/56983
Inventor 朱春华刘晓东龚晖池洪树陈翠腾陈珍刘斌琼黄瑜
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com