Amplification primer for detecting polymorphism of children's calcium absorption genes and application of amplification primer
A technology of gene polymorphism and amplification primers, which is applied in the detection primers and application fields of nucleotide polymorphisms at the SNP site of FokI, can solve the problems of high cost, poor calcium absorption by children, and difficult separation of hybrids. Type and other problems, to achieve the effect of low false positive and false negative rate, intuitive results and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] Example 1 Assembling of the kit for detecting polymorphism of calcium absorption genotype in children according to the present invention
[0077] Specifically, the main reagents in the child calcium absorption genotype polymorphism detection kit according to the present invention include:
[0078] (1) PCR amplification reagents: 10× buffer, dNTPs, DNA polymerase, pure water, and PCR amplification primers for detecting FokI (rs2228570) sites, among which,
[0079] FokI (rs2228570) upstream primer (SEQ ID NO. 1): GCGGAACAGCTTGTCCACCC;
[0080] FokI (rs2228570) downstream primer (SEQ ID NO. 2): GCTCAGAACTGCTGGAGTGG.
[0081] (2) Enzyme digestion reagent: RsaI restriction endonuclease and pure water.
Embodiment 2
[0082] Example 2: Detection example of the kit for detecting the genotype polymorphism of calcium absorption in children according to the present invention
[0083] (1) Obtain test samples :
[0084] Choose 5 samples from kindergarten children aged 3-5 years old, take a swab of oral mucosa, wipe the inside of the oral cavity for 20 times, take out the swab, fold off the cotton wool, and place it in 1.5ml of Chelex 100 liquid 150μl by centrifugation Submerge the specimen in the tube, add 20 μL of 20 mg / mL proteinase K in a 50°C water bath overnight, boil for 10 min, place on ice for 3 min, centrifuge at 12000 r / min for 2 min, and take the supernatant to obtain the sample DNA to be tested.
[0085] (2) Testing procedure:
[0086] PCR amplification: using the DNA obtained in step (1) as a template, the PCR amplification primer pair for FokI (rs2228570) site polymorphism in the kit provided in Example 1 is used for PCR amplification. The reaction system is as follows:
[0087]
[0088] ...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap