Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Combinatorial biosynthesis method of resveratrol

A technology of resveratrol synthase and resveratrol, which is applied in the field of bioengineering to reduce production costs and facilitate industrial production

Inactive Publication Date: 2016-12-07
SOUTH CHINA AGRI UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Third, the microbial preparation of stilbenes such as resveratrol is still in its infancy, and there are many problems to be solved. A set of synthetic preparation system for resveratrol can be perfected and optimized, which will definitely have a great impact on the industry of resveratrol. have an important role in promoting

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Combinatorial biosynthesis method of resveratrol
  • Combinatorial biosynthesis method of resveratrol
  • Combinatorial biosynthesis method of resveratrol

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] 1. Construct the expression vector pQE-30-promoter-RBS-TAL coding gene-terminator, referred to as pA, such as figure 1 shown; and transfer it into host strain A (E.coli ATCC31884, purchased from the American Type Culture Collection, https: / / www.atcc.org / Products / All / 31884.aspx) to obtain engineering strain A; Wherein, the vector pQE-30 is purchased from QIAGEN; the Genebank accession number of the TAL coding gene is KF770992.

[0047] The sequence of the promoter is:

[0048] 5'-GTCGCGTAATGCTTAGGCACAGGATTGATTTGTCGCAATGATTGACACGATTCCGCTTGACGCTGCGTAAGGTTTTTGTAATTTTACAAGGCAACCTTTTATTCACTA-3'.

[0049] The sequence of the RBS is: 5'-GAAGGAGATATACAT-3'.

[0050] The sequence of the terminator is:

[0051] 5'-AGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTAT-3'.

[0052] 2. Pick a single colony of engineering bacteria A until it is filled with 100mL YM9 culture solution (1L YM9 formula: 17.1g Na 2 HPO 4 12H 2 O, 3g KH 2 PO 4 , 0.5g NaCl, 1g NH 4 Cl, 10g yeast ex...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a combinatorial biosynthesis method of resveratrol, and belongs to the field of bioengineering. Two production modules are constructed; in the first production module, recombinant escherichia coli can express tyrosine ammonia lyase through a constructed constitutive expression system and achieve denovo synthesis of p-coumaric acid; in the second production module, the recombinant escherichia coli can express p-coumaric acyl coenzyme A ligase and resveratrol synthase through the constructed constitutive expression system and synthesize resveratrol through p-coumaric acid produced by the first module. According to the method, the advantages that the two production modules can conduct regulation separately and can better achieve the maximum production value theoretically are achieved through step-by-step culture; the constitutive expression system which does not need an inducer and is efficient is provided, and therefore usage of a toxic inducer is avoided; through denovo synthesis of resveratrol, the production cost is reduced, and industrial production is better promoted.

Description

technical field [0001] The invention belongs to the field of bioengineering, in particular to a combined biosynthesis method of resveratrol. Background technique [0002] The chemical name of resveratrol is (E)-5-[2-(4-hydroxyphenyl)-vinyl]-1,3-benzenediol, and the English name is Resveratrol, which belongs to non-flavonoid polyphenols A species with the molecular formula C 14 h 12 , with a relative molecular mass of 228.25, was first discovered in grapevines as a plant stress-resistant substance. With the in-depth study of resveratrol pharmacology by scholars from various countries, the trans isomer of resveratrol has been pointed out to have various biological activities related to improving human health, such as delaying aging, protecting cardiovascular system and reducing lipid accumulation. It is precisely because of this that trans-structure resveratrol has been developed and applied in the fields of health food, skin care cosmetics and auxiliary medicines. The inc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P7/22C12N15/70C12R1/19
CPCC12P7/22C12N9/1029C12N9/88C12N9/93C12N15/70C12Y203/01095C12Y403/01023C12Y602/01012
Inventor 林俊芳梁景龙郭丽琼叶志伟
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com