Combinatorial biosynthesis method of resveratrol
A technology of resveratrol synthase and resveratrol, which is applied in the field of bioengineering to reduce production costs and facilitate industrial production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] 1. Construct the expression vector pQE-30-promoter-RBS-TAL coding gene-terminator, referred to as pA, such as figure 1 shown; and transfer it into host strain A (E.coli ATCC31884, purchased from the American Type Culture Collection, https: / / www.atcc.org / Products / All / 31884.aspx) to obtain engineering strain A; Wherein, the vector pQE-30 is purchased from QIAGEN; the Genebank accession number of the TAL coding gene is KF770992.
[0047] The sequence of the promoter is:
[0048] 5'-GTCGCGTAATGCTTAGGCACAGGATTGATTTGTCGCAATGATTGACACGATTCCGCTTGACGCTGCGTAAGGTTTTTGTAATTTTACAAGGCAACCTTTTATTCACTA-3'.
[0049] The sequence of the RBS is: 5'-GAAGGAGATATACAT-3'.
[0050] The sequence of the terminator is:
[0051] 5'-AGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTAT-3'.
[0052] 2. Pick a single colony of engineering bacteria A until it is filled with 100mL YM9 culture solution (1L YM9 formula: 17.1g Na 2 HPO 4 12H 2 O, 3g KH 2 PO 4 , 0.5g NaCl, 1g NH 4 Cl, 10g yeast ex...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap