A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof
A technology of genetically engineered bacteria and resveratrol, applied in the fields of synthetic biology and metabolic engineering, can solve the problems of unstable expression of recombinant plasmids, high cost of raw materials, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Embodiment 1: Construction of recombinant vector pTKIP-sts and pTKIP-tal-4cl;
[0057] (1) The reported tal of Rhodotorula glutinis, 4cl of parsley (Petroselinum crispum) and sts of grape (Vitis vinifera) were obtained from the NCBI website, and these three genes were fully synthesized after codon optimization (by provided by Shanghai Jierui Biological Engineering Co., Ltd.) to obtain cloning vectors pUC57-tal, pUC57-4cl and pUC57-sts; the sequences of gene tal, 4cl and sts are as SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 shown.
[0058] (2) Using pUC57 carrying the target gene as a template to amplify the genes sts, tal and 4cl respectively, the gene fragment sts and the vector pETDuet-1 were digested and ligated with restriction endonucleases BamH I and Xho I to construct the recombinant vector pET -sts; gene fragment tal and vector pETDuet-1 were cut and ligated with restriction endonucleases Nco I and Hind III to construct recombinant vector pET-tal; gene fragment 4...
Embodiment 2E
[0063] Construction of Example 2E.coli BW25113 (ΔtyrR::sts)
[0064] (1) The plasmid pTKS / CS was digested and linearized as a template, and tyrR-CS1 / tyrR-CS2 was used as primers to amplify the tetracycline resistance gene (tetA).
[0065] tyrR-CS1: GTGTCATATCATCATATTAATTGTTCTTTTTTCAGGTGAAGGTTCCCATG (SEQ ID NO: 6);
[0066] tyrR-CS1: TGGTGTTGCACCATCAGGCATATTCGCGCTTACTCTTCGTTCTTCTTCTG (SEQ ID NO: 7);
[0067] Among them, in the primers, the underlined and bold sequences are the sequences at both ends of the tetA gene, and the upstream of the underlined and bold sequences are the homologous sequences on both sides of the tyrR gene on the chromosome of Escherichia coli.
[0068] (2) Construction of E.coli BW25113 / pTKRed: The plasmid pTKRed was introduced into E.coli BW25113 (Novagen) strain cells by electroporation, coated with 100 mg / L spectinomycin-resistant plates, and cultured at 30°C for 12-16 hours.
[0069] (3) tetA is recombined into the strain chromosome to replace ...
Embodiment 3
[0078] Example 3: Construction of E.coli BW25113 (ΔtyrR::sts, ΔtrpED::tal-4cl)
[0079] Using the same construction method in Example 2, the steps are as follows:
[0080] (1) Amplification of the tetA fragment for knocking out trpED, the primers used are trpED-CS1 and trpED-CS2.
[0081] trpED-CS1:CCCGCCTAATGAGCGGGCTTTTTTTTGAACAAAATTAGAGAATAACAATG (SEQ ID NO: 10);
[0082] trpED-CS2:ACGATTTTCGCTAAAACGGTTTGCATCATTTACCCTCGTGCCGCCAGTGC (SEQ ID NO: 11);
[0083] Among them, in the primers, the underlined and bold sequences are the sequences at both ends of the tetA gene, and the upstream of the underlined and bold sequences are homologous sequences on both sides of the trpED gene on the chromosome of Escherichia coli.
PUM
Property | Measurement | Unit |
---|---|---|
Relative molecular weight | aaaaa | aaaaa |
Relative molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com