Supercharge Your Innovation With Domain-Expert AI Agents!

A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof

A technology of genetically engineered bacteria and resveratrol, applied in the fields of synthetic biology and metabolic engineering, can solve the problems of unstable expression of recombinant plasmids, high cost of raw materials, etc.

Inactive Publication Date: 2016-10-19
SHANGHAI INST OF PHARMA IND +1
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0019] The present invention aims at the above-mentioned existing problems, adopts the method of chromosome integration, recombines the key gene of the resveratrol synthesis pathway into the chromosome of Dacheng bacteria, and obtains a recombinant strain capable of synthesizing resveratrol with glucose as a substrate , so as to solve the problem of unstable expression of recombinant plasmids and solve the problem of high cost of raw materials that is not conducive to industrialization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof
  • A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof
  • A genetically engineered bacterium for synthesizing resveratrol and a constructing method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1: Construction of recombinant vector pTKIP-sts and pTKIP-tal-4cl;

[0057] (1) The reported tal of Rhodotorula glutinis, 4cl of parsley (Petroselinum crispum) and sts of grape (Vitis vinifera) were obtained from the NCBI website, and these three genes were fully synthesized after codon optimization (by provided by Shanghai Jierui Biological Engineering Co., Ltd.) to obtain cloning vectors pUC57-tal, pUC57-4cl and pUC57-sts; the sequences of gene tal, 4cl and sts are as SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 shown.

[0058] (2) Using pUC57 carrying the target gene as a template to amplify the genes sts, tal and 4cl respectively, the gene fragment sts and the vector pETDuet-1 were digested and ligated with restriction endonucleases BamH I and Xho I to construct the recombinant vector pET -sts; gene fragment tal and vector pETDuet-1 were cut and ligated with restriction endonucleases Nco I and Hind III to construct recombinant vector pET-tal; gene fragment 4...

Embodiment 2E

[0063] Construction of Example 2E.coli BW25113 (ΔtyrR::sts)

[0064] (1) The plasmid pTKS / CS was digested and linearized as a template, and tyrR-CS1 / tyrR-CS2 was used as primers to amplify the tetracycline resistance gene (tetA).

[0065] tyrR-CS1: GTGTCATATCATCATATTAATTGTTCTTTTTTCAGGTGAAGGTTCCCATG (SEQ ID NO: 6);

[0066] tyrR-CS1: TGGTGTTGCACCATCAGGCATATTCGCGCTTACTCTTCGTTCTTCTTCTG (SEQ ID NO: 7);

[0067] Among them, in the primers, the underlined and bold sequences are the sequences at both ends of the tetA gene, and the upstream of the underlined and bold sequences are the homologous sequences on both sides of the tyrR gene on the chromosome of Escherichia coli.

[0068] (2) Construction of E.coli BW25113 / pTKRed: The plasmid pTKRed was introduced into E.coli BW25113 (Novagen) strain cells by electroporation, coated with 100 mg / L spectinomycin-resistant plates, and cultured at 30°C for 12-16 hours.

[0069] (3) tetA is recombined into the strain chromosome to replace ...

Embodiment 3

[0078] Example 3: Construction of E.coli BW25113 (ΔtyrR::sts, ΔtrpED::tal-4cl)

[0079] Using the same construction method in Example 2, the steps are as follows:

[0080] (1) Amplification of the tetA fragment for knocking out trpED, the primers used are trpED-CS1 and trpED-CS2.

[0081] trpED-CS1:CCCGCCTAATGAGCGGGCTTTTTTTTGAACAAAATTAGAGAATAACAATG (SEQ ID NO: 10);

[0082] trpED-CS2:ACGATTTTCGCTAAAACGGTTTGCATCATTTACCCTCGTGCCGCCAGTGC (SEQ ID NO: 11);

[0083] Among them, in the primers, the underlined and bold sequences are the sequences at both ends of the tetA gene, and the upstream of the underlined and bold sequences are homologous sequences on both sides of the trpED gene on the chromosome of Escherichia coli.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Relative molecular weightaaaaaaaaaa
Relative molecular weightaaaaaaaaaa
Login to View More

Abstract

A genetically engineered bacterium for synthesizing resveratrol is disclosed. The genetically engineered bacterium is obtained by knocking tyrR and trpED which are genes limiting tyrosine synthesis from glucose out of E.coli BW25113, and the chromosome is recombined with a tyrosine deaminase gene tal of rhodotorula glutinis, a petroselinum crispum p-coumaric acid: coenzyme A ligase gene 4cl and a stilbene synthase gene sts of grapes. The genetically engineered bacterium adopts glucose as a substrate to synthesize the resveratrol.

Description

technical field [0001] The invention belongs to the field of synthetic biology and metabolic engineering, and specifically relates to the construction of Escherichia coli engineering bacteria capable of synthesizing resveratrol by using techniques such as gene knockout and gene recombination and a construction method thereof. Background technique [0002] Resveratrol is a non-flavonoid polyphenol compound with the chemical name 3,4',5-trihydroxystilbene (3,4',5-trihydroxystilbene), mainly found in grapes, peanuts, mulberry and knotweed among other plants. A large number of studies have shown that resveratrol has various pharmacological effects such as anti-cancer, anti-inflammation, and cardiovascular protection [1]~[5] . Resveratrol can also be used as an additive in cosmetics and health care products, and there are related products on the market, such as Shaklee (Shaklee) VIVIX natural plant extracts, American Swanson red wine essence nutrition capsules and red wine esse...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12N15/60C12N15/54C12N15/53C12N15/52C12R1/19
Inventor 朱宝泉刘学珍林军胡海峰周斌
Owner SHANGHAI INST OF PHARMA IND
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More