Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Monoclonal antibody against phosphomannose isomerase (PMI) protein and application thereof

A monoclonal antibody and protein technology, applied in anti-enzyme immunoglobulin, measuring devices, instruments, etc., to achieve extremely strong specificity and sensitivity

Inactive Publication Date: 2016-02-17
BEIJING PROTEIN INNOVATION
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The key technology is to prepare highly specific antibodies, so far there is no report about PMI antibodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Monoclonal antibody against phosphomannose isomerase (PMI) protein and application thereof
  • Monoclonal antibody against phosphomannose isomerase (PMI) protein and application thereof
  • Monoclonal antibody against phosphomannose isomerase (PMI) protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The preparation of embodiment 1 recombinant PMI protein

[0029] 1. Gene cloning

[0030] The nucleic acid sequence of NC_004088.1 in PMI monoclonal Genbank, design specific upstream primer PMI-F: TATGTACATATGCAAAAACTCATTAACTC specific downstream primer PMI-R: AGTGCTCGAGCTTGTTGTAAACACGC, amplified from the reverse transcription product in lymphocytes, including coding from position 411 to The gene fragment of the 750th amino acid. During the PCR process, NdeI and XhoI restriction sites were added to the 5' and 3' ends of the gene, respectively. The PCR product was separated by agarose gel electrophoresis and recovered. The recovered fusion protein gene and the plasmid vector pET-30a used for expression were digested with NdeI and XhoI respectively, recovered by electrophoresis again, and ligated with T4DNA ligase. The ligation product was transformed into Escherichia coli competent cell BL21, the clones on the plate were picked and inoculated, the plasmid DNA was extrac...

Embodiment 2

[0033] The establishment of embodiment 2 hybridoma cell lines

[0034] 1. Immunity

[0035] The cross-linked polypeptide in Example 1 was emulsified with complete Freund's adjuvant (Sigma Company), and immunized with 4-6 week-old female Balb / c mice (purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.), subcutaneously in the abdomen. Inject each mouse at 6 points with a dose of 60 μg / mouse. Immunization was boosted every 14 days, and the antigen was emulsified with Freund's incomplete adjuvant (Sigma Company) at a dose of 30 μg per mouse. 7 days after the third booster immunization, indirect ELISA (wavelength 450nm) was used to detect the polyantibody titer of the anti-immunogen in the mouse serum. 50μg / only.

[0036] 2. Cell Fusion

[0037] Aseptically prepare the mouse splenocyte suspension that reaches the immune standard, mix it with mouse myeloma cell sp2 / 0 (ATCC) at a ratio of 5:1, and centrifuge at 1500rpm for 5min. After the supernatant wa...

Embodiment 3

[0042] Example 3 Preparation of Monoclonal Antibody by Ascites Induction Method

[0043] 1. Ascites preparation

[0044] Cells in the logarithmic growth phase were washed with serum-free medium and suspended, counted to 5×10 5 , 1ml. The suspended cells were injected intraperitoneally into mice previously sensitized with paraffin oil. Ascites collection was started 7 days later. The removed ascites was centrifuged at 4000rpm for 10min at 4°C. Carefully suck out the ascites in the middle and collect in a centrifuge tube, and store at 4°C or -20°C.

[0045] 2. Purification of monoclonal antibodies

[0046] Antibody was purified from ascitic fluid by HiTraprProteinAFF (GE Company) affinity chromatography according to the instructions. The purity was identified by SDS-PAGE gel, and the concentration was determined by Bradford method. Purified antibodies were stored at -20°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a monoclonal antibody used for specifically recognizing a non-antibiotic safe screening marker PMI in a transgenic plant and a preparation method thereof. The objective of the invention is to provide a key reagent material for immunological detection of the screening marker PMI in a natural transgenic species (corn, paddy rice, cotton, etc.) A PMI gene is a biologically safe marker gene. An antigen for preparation of the antibody is a soluble full-length PMI recombinant protein expressed by Escherichia coli; the eventually obtained antibody belongs to IgG1 subtype; and a sequence coding the variable region of the antibody is obtained through gene cloning. According to results of western blotting detection of a natural transgenic paddy rice material, the antibody has good specificity and can be used for detection of a transgenic material.

Description

technical field [0001] The invention relates to a monoclonal antibody for identifying non-antibiotic safety screening marker PMI (phosphomannose isomerase), which can be used to prepare a kit for detecting PMI protein in transgenic plants, and belongs to the field of biological detection. Background technique [0002] With the continuous emergence of genetically modified products, the following problem is the safety evaluation and determination of genetically modified products. In the cultivation and later identification of transgenic varieties, selection markers and reporter genes for transformation are inseparable. The most commonly used selection markers include antibiotic resistance selection marker genes and herbicide resistance genes. Such resistance selection marker genes may be Gene pollution will be caused by gene drift, which will have adverse effects on the environment (Wei Wei, Ma Keping. How to face gene flow and gene pollution [J]. China Agricultural Science an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/40G01N33/577
Inventor 刘国振尹长城荣瑞娟武鹏程兰金苹韦汉福魏健郝育杰刘丽娟吴琳刘斯奇
Owner BEIJING PROTEIN INNOVATION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com