Supercharge Your Innovation With Domain-Expert AI Agents!

Alginic acid lyase SHA-5 gene and prokaryotic expression vector thereof

An alginate lyase, SHA-5 technology, applied in genetic engineering, plant genetic improvement, introduction of foreign genetic material using vectors, etc., can solve the problem that it is difficult to meet application requirements, high cost, and wild-type alginate decomposing bacteria produce enzymes. To solve the problems of low amount and other problems, to achieve the effect of broad substrate specificity, easy operation and convenient industrial production

Active Publication Date: 2016-01-20
KUNMING UNIV OF SCI & TECH
View PDF9 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the wild-type alginate-decomposing bacteria have low enzyme production and high cost, and it is difficult to meet the actual application requirements.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alginic acid lyase SHA-5 gene and prokaryotic expression vector thereof
  • Alginic acid lyase SHA-5 gene and prokaryotic expression vector thereof
  • Alginic acid lyase SHA-5 gene and prokaryotic expression vector thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 : Marina catena alginatilytica Preparation and Detection of SH-52 Genomic DNA

[0037] used in the present invention Marina catena alginatilytica SH-52 is a strain screened by our laboratory. The preparation of SH-52 genomic DNA adopts the extraction method of common bacterial genome. The specific content is as follows: Take 2 mL of overnight culture liquid and centrifuge at 4000 rpm for 2 min at 4 ° C. Discard the supernatant and collect the bacteria. Add 100ulSolutionI suspension bacteria, 30ul 10% SDS and 1ul 20mg / ml proteinase K, mix well, and incubate at 37°C for 1 hour; add 100ul 15mol / L NaCl, mix well; add 20ul CTAB / NaCl solution (CTAB10%, NaCl0.7mol / L), Mix well at 65°C for 10 minutes; add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) to mix, centrifuge at 12,000 rpm for 5 minutes; take the supernatant, add 2 times the volume of absolute ethanol, 0.1 times the volume of 3mol / LNaOAC, placed at -20°C for 30 minutes; centrifuged at...

Embodiment 2

[0038] Example 2 : Alginate lyase SHA-5 Gene amplification and TA cloning

[0039] alginate lyase SHA-5 gene amplification and cloning figure 2 As shown, first find out from the whole genome sequencing results SHA-5 The full-length gene sequence, and design a pair of specific primers, the sequence is as follows:

[0040] SHA-5-F: GGATCC ATGAAAAAAAATTTAACGATCATAT

[0041] SHA-5-R: GCGGCCGC CTATTGAACTAGTTTGATGGAATAT

[0042] The primer at the 5' end has the characteristic sequence of GGATCC, which forms the restriction site of BamHI; the characteristic sequence of GCGGCC is added at the 3' end, forming the restriction site of NotI.

[0043] Add 10 ng of Marina catena alginatilytica SH-52 genomic DNA is used as a template, and 50ng of specific primers SHA-5-F and SHA-5-R, 2.5μl of IdNTP (10mM), 2.5μl of Pfu reaction buffer and 0.5μl of pfu (5U / ul) are added for polymerization Enzyme (Beijing Quanshijin Biotechnology Co., Ltd.), add double distilled water to make th...

Embodiment 3

[0044] Example 3 : Prokaryotic expression vector pGEX-4T-1- SHA-5 build

[0045] pGEX-4T-1- SHA-5 A build strategy such as Figure 6 As shown, the purified prokaryotic expression vectors pGEX-4T-1 (purchased from GE Healthcare) and pMD19T- SHA-5 , separated the cut vector and insert fragments by agarose gel electrophoresis, and recovered the vector fragments pGEX-4T-1 (4.9kb) and pMD19T- SHA-5 produced by cutting SHA-5 The DNA fragment of the gene (about 1.7kb), and then use the ligase kit of TaKaRa to connect the pGEX-4T-1 vector fragment and SHA-5 The DNA fragment of the gene produces the prokaryotic expression vector pGEX-4T-1- SHA-5 . Use the ligation reaction mixture to transform high-efficiency E. coli competent cells Trans1-T1 (Beijing Quanshijin Biotechnology Co., Ltd.), and spread the transformed E. coli on a plate added with ampicillin (Amp, 100mg / L). Cultivate overnight at 37°C, screen Amp-resistant recombinant colonies, and extract plasmids from Amp-resist...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an alginic acid lyase SHA-5 gene. The nucleotide sequence of the alginic acid lyase SHA-5 gene is shown as SEQ ID NO:1. A prokaryotic expression vector of the alginic acid lyase SHA-5 gene is structured, the expression product alginic acid lyase SHA-5 can be obtained in a short time through the vector, and the vector has wide substrate specificity; both polymannuronic acid PolyM and polyguluronic acid PolyG can be used as a substrate, the enzyme activity reaches 17 U / mg, and the alginic acid lyase SHA-5 is difunctional and has wide application prospects. The prokaryotic expression vector and an integral expression system are easy to operate, and industrial production is convenient.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, in particular to an alginate lyase SHA-5 gene and its prokaryotic expression vector pGEX-4T-1- SHA-5 , the vector highly expresses the alginate lyase protein SHA-5. Background technique [0002] In recent years, the development and utilization of marine resources has gradually become a research hotspot. Because of its unique physical and chemical properties, alginic acid has broad application prospects in the fields of food, medicine and chemical industry. Alginate oligosaccharides have become the focus of new drug development because of their various physiological activities. At the same time, as one of the most abundant marine biomass, alginic acid has the following advantages: (1) high photosynthetic efficiency, fast growth, high yield, and abundant resources; (2) growth does not occupy arable land; (3) hardly contains wood The content of cellulose is very small, the pretreatment...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/60C12N15/70
Inventor 伊日布斯何漫漫李曙梅吴铭杰李勤超严金平
Owner KUNMING UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More