Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Endolysin derived from Vibrio parahaemolyticus phage, and application of endolysin

A technology of Vibrio hemolyticus and bacteriophage, applied in the field of endolysin, can solve the problem that the prevention and control of Gram-negative bacteria is still less and other problems, and achieve the effect of significant bactericidal effect

Active Publication Date: 2015-12-30
OCEAN UNIV OF CHINA
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although the domestic use of genetic engineering technology to construct endolysin-producing strains has made some progress, an important problem in the research and production process is that most of the prepared endolysins are concentrated in Gram-positive bacteria. Prevention and detection of Gram-negative bacteria, especially Vibrio parahaemolyticus, is still less researched

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Endolysin derived from Vibrio parahaemolyticus phage, and application of endolysin
  • Endolysin derived from Vibrio parahaemolyticus phage, and application of endolysin
  • Endolysin derived from Vibrio parahaemolyticus phage, and application of endolysin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Prediction of endolysin protein function

[0031] The present inventor isolated a virulent phage qdvp001 of Vibrio parahaemolyticus from sewage. After whole genome sequencing and analysis, it was identified that the protein encoded by the phage ORF60 had 56% similarity in amino acid sequence with the substrate and tail hydrolase of Vibrio phage ICP1. Domain prediction analysis of ORF60-encoded protein Lysqdvp001 was performed using SMART software. The domain prediction results are as follows figure 1 As shown, the 9-65 amino acid region of Lysqdvp001 is a highly conserved functional region, belonging to the PG_binding (PF01471) domain, which is related to the binding of cell wall peptidoglycan. The 123-216 amino acid interval of Lysqdvp001 is a highly conserved functional region, which belongs to the CHAP family (PF05257), which is related to the hydrolysis of prokaryotic cell wall peptidoglycan.

Embodiment 2

[0032] Example 2: High expression of endolysin in Escherichia coli

[0033] 1. Construction of recombinant plasmids

[0034] According to the endolysin gene sequence (SEQ ID No: 2), primers were designed, upstream primer: CGGGATCCATGACTTTAATTCGTAAGGGTAGTCG (SEQ ID No: 3), downstream primer: CCGCTCGAGTTAAGCTTCGTTATTACTAGTTACATCTGA (SEQ ID No: 4), restriction enzymes BamHI and XhoI. The endolysin gene was amplified by PCR, and 25 μL of the PCR recovered product was cloned into the multiple cloning site BamHI and XhoI of the pET-30a vector to obtain a recombinant plasmid, which was transformed into Escherichia coli Rosetta (DE3). Single clones were picked and cultured in LB liquid medium with shaking at 37°C for 5 hours, and then sent to Shanghai Sangong for sequencing. Sequencing results showed that the plasmid had the nucleotide sequence shown in SEQIDNo: 2, and the protein expressed by the gene was named Lysqdvp001, and the gene encoded the amino acid residue sequence shown ...

Embodiment 3

[0037] Example 3: Taking Vibrio parahaemolyticus ATCC17802 as the target bacterium to test the antibacterial effect of endolysin LysVPp1

[0038] Pick a single colony of Vibrio parahaemolyticus ATCC17802 into 300mL2216E medium, cultivate overnight, centrifuge the bacteria, reconstitute with 100mM EDTA for 5min, wash the cells twice with pure water, and then store them at -80°C. Before measuring the activity, the bacteria The precipitate was reconstituted with 50mmol / LpH8.2 Tris containing 0.1% TritonX-100. Add 100 μL of recombinant protein Lysqdvp001 solution (400 μg / mL) to 100 μL of bacterial reconstitution solution, and mix the buffer and lysozyme (400 μg / mL) with the bacterial reconstitution solution as the blank group and positive control group respectively, and culture under the same conditions , Measure the OD450 value with a microplate reader, and the decrease in absorbance reflects that the bacteria are lysed.

[0039] The result is as image 3 As shown, the absorban...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and particularly relates to an endolysin derived from the Vibrio parahaemolyticus phage, and application of the endolysin. The endolysin is derived from the Vibrio parahaemolyticus phage of which the amino acid sequence is all or a part of the shown amino acid sequence SEQ ID No: 1. Sequence analysis shows that the endolysin is a lyase in the phase, and the lyase enables a bacterial cell wall to be cracked; test confirms that protein formed from the amino acid sequence is better in bactericidal activity. The endolysin has an obvious bactericidal effect on in vitro Vibrio parahaemolyticus after being expressed and purified by a suitable expression vector existing in the market, and can be applied to preparation of a Vibrio parahaemolyticus bacteriostat.

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to an endolysin derived from Vibrio parahaemolyticus phage and application thereof. Background technique [0002] Vibrio parahaemolyticus is a Gram-negative polymorphic bacillus or slightly curved Vibrio, which is a secondary harmful microorganism and belongs to the genus Vibrio in the Vibrio family. Seawater, seabed sediments, and seafood such as fish and shellfish. With the extensive and long-term use of antibiotics, the increasingly serious drug-resistant Vibrio parahaemolyticus in food and the environment has affected the treatment of human infection with Vibrio parahaemolyticus. Can new biological antibacterial agents be developed to replace chemical Antibiotics are currently a challenge for researchers. [0003] Phage endolysins are a class of lytic enzymes capable of cleaving bacterial cell walls. Although the ability of phage endolysin to lyse bacteria was...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N1/21C12N7/00A61K38/51A61P31/04
CPCA61K38/51C12N7/00C12N9/88A61K2300/00
Inventor 王静雪林洪王伟宇
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com