Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker for rice gelatinization temperature control gene and application thereof

A technology of gelatinization temperature and gene regulation, applied in the field of plant biology, can solve the problems of time-consuming detection, difficult to meet the needs of large-scale molecular breeding, and high cost, and achieve the effects of improving efficiency, improving breeding efficiency, and moderately labeling amplified fragments

Inactive Publication Date: 2015-07-22
SOUTH CHINA AGRI UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the limitations of the stability and detection efficiency of these markers, for example, CAPS requires PCR amplification, enzyme digestion, and electrophoresis to separate the enzyme-digested fragments, resulting in time-consuming and high-cost detection, which is difficult to meet the needs of large-scale molecular breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for rice gelatinization temperature control gene and application thereof
  • Molecular marker for rice gelatinization temperature control gene and application thereof
  • Molecular marker for rice gelatinization temperature control gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Rice SSIIa Primer design and amplified fragment analysis of functional gene marker SSIIa-GC / TT

[0036] 1. Primer design

[0037] Regulating genes through the gelatinization temperature of rice SSIIa Comparison of allele sequences in different rice varieties, the difference between low gelatinization temperature rice varieties and high gelatinization temperature rice varieties SSIIa The 8th exon of the gene coding region finds the GC / TT variation composed of two consecutive SNPs on the base sequence, and designs the functional marker SSIIa-GC / TT covering the different sites, and at the same time, the 3'end of the allele-specific primer 3 bases introduce mismatch bases to increase specificity ( figure 1 ). The SSIIa-GC / TT is composed of 4 primers SSIIa-O-F, SSIIa-O-R, SSIIa-F-GC and SSIIa-R-TT. The primer sequences (5’-3’) are as follows:

[0038] SSIIa-O-F: CGTTCGACCCGTTCGAGGACAC

[0039] SSIIa-O-R: GCCAAGCTTCTTCAGGGAGGCTA

[0040] SSIIa-F-GC: AAGTACAAGAGAGCTGGAGGG ...

Embodiment 2

[0045] Example 2 Using molecular marker SSIIa-GC / TT to detect the genotypes of 6 rice varieties gelatinization temperature regulation genes

[0046] 1. Extraction of rice genomic DNA

[0047] Six rice varieties were used as materials: Zhenshan 97B, Minghui 63, Y Huanong B, 9311, Yuefeng Xinzhan and Zhenshan 97B / Yuefeng Xinzhan. Select the tender leaves of a single rice plant, and extract rice genomic DNA by the CTAB method. The specific steps are as follows: (1) Take an appropriate amount of fresh leaves and place them in a 2 mL centrifuge tube, add liquid nitrogen to mash, and add 1 mL CTAB extract to the centrifuge tube. , Shake well; (2) Place in a 65℃ water bath or thermostat, shake gently every 10 minutes, take it out after 30 to 45 minutes; (3) After cooling for 2 minutes, add chloroform-isoamyl alcohol (24:1) ) To the full tube, shake up and down vigorously to mix the two evenly; (4) Put the centrifuge tube in the centrifuge at 15,000 r / min and centrifuge for 10 minutes an...

Embodiment 3

[0057] Example 3 Application of rice SSIIa Identification of Single Rice Plants by Gene Functional Marker SSIIa-GC / TT

[0058] 1. Testing materials: 47 rice germplasm materials from different sources were selected.

[0059] 2. Extraction of rice genomic DNA: same as Example 2.

[0060] 3. Functional marker SSIIa-GC / TT amplification: the same as in Example 2.

[0061] 4. Capillary electrophoresis detection and genotype determination of amplified products:

[0062] Dilute the amplified product and transfer it to Fragment Analyzer® Automated CE System (AATI, USA) for detection, follow the operating instructions of the kit DNF-910-K2000, and use PROSize® 2.0 data analysis software for data analysis, and finally Genotype is judged:

[0063] The amplified products are 293 bp and 192 bp fragments, showing that the genotype of the marker individual is CG / CG homozygous ( image 3 1st to 3rd, 6, 8, 10, 12 to 13, 15, 17 to 19, 21, 27, 29, 32 to 34, 36, 38, 41 to 42 test samples); the amplified pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant biology, and particularly discloses a molecular marker for a rice gelatinization temperature control gene and the application thereof. The molecular marker consists of a pair of outer primers SSIIa-O-F and SSIIa-O-R and a pair of inner primers SSIIa-F-GC and SSIIa-R-TT, wherein the primer sequences are shown as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4; an amplified fragment of the marker is moderate and is high in specificity; the rice gelatinization temperature control gene SSIIa can be genotyped by utilizing the marker only through simple PCR to distinguish rice varieties with different gelatinization temperatures; the SSIIa detecting efficiency can be improved by utilizing the marker; auxiliary selection of the molecular marker of the rice gelatinization temperature is realized; the breeding efficiency is improved; the requirement on large-scale molecular breeding is met.

Description

technical field [0001] The invention relates to the field of plant biotechnology, in particular to a molecular marker and application of a rice gelatinization temperature regulation gene. Background technique [0002] Rice is an important crop in my country, and the quality of rice is directly related to the economic benefits of rice production and the quality of life of the people. Gelatinization temperature is the temperature at which starch grains in rice absorb water and lose crystallinity and expand irreversibly to form starch paste. It is closely related to the physical properties of starch in rice and is crucial to the cooking quality of rice. Metrics. The traditional selection method for rice gelatinization temperature traits is often to indirectly select rice quality through biochemical means. This method has the disadvantages of long cycle, low efficiency, and poor accuracy. [0003] Soluble starch synthase (SSS) is one of the key enzymes controlling amylopecti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68
Inventor 黄翠红陈立凯周丹华郭涛罗文龙陈志强王慧
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com