Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vaccine for prevention and control of neosporiasis of cattle as well as preparation method and application of vaccine

A bovine neosporosis and vaccine technology, applied in the field of genetic engineering of parasitic disease vaccines, can solve problems such as low protection rate, inability to use neosporosis, and poor immune effect, and achieve high transgenic efficiency and high safety Effect

Inactive Publication Date: 2015-07-22
YANBIAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the current research on Neospora canis vaccines adopts traditional methods, such as using the surface antigen protein gene of Neospora caninum to prepare recombinant protein subunit vaccines, or using eukaryotic expression vectors to prepare nucleic acid vaccines, etc., to prepare subunit vaccines or nucleic acid vaccines. Vaccines have problems such as poor immune effect and low protection rate, and cannot be used for the prevention and control of neosporosis
Moreover, there is no bovine-derived N. canis-related vaccine at home and abroad, and there are no related reports on gene adjuvanted recombinant adenovirus vector vaccines.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine for prevention and control of neosporiasis of cattle as well as preparation method and application of vaccine
  • Vaccine for prevention and control of neosporiasis of cattle as well as preparation method and application of vaccine
  • Vaccine for prevention and control of neosporiasis of cattle as well as preparation method and application of vaccine

Examples

Experimental program
Comparison scheme
Effect test

no. 1 example

[0056] The vaccine used for the prevention and control of bovine neosporosis of the present invention is a gene adjuvanted recombinant adenovirus vector vaccine, and the nucleotide sequence encoding the vaccine antigen is:

[0057] CGGGATCCGCCACCATGGCGAGGAGAGGAAGCATGCAGCACCGTCGTGGAGGGCTCAAGTCGAAGGCTGGCAAGCTGATGGTAGTTTGCATGGGTGGAGTTTTGTTGATTGCCAGCGGTCAGGCTGGTGCAGAAAAACTCCGTGAAGGACTTCAACATCGGGGTTTGCAGCAACAAGCTAGCACGACTGTTACACCAACAATCAACGGTGCAACCGCTACATGTACTTTCCCAACGGCAGTCGGACAACAAACCGTCGCAGCTAGTAGTGGCTTGAAGCTCTCAAAAGAAAGCCTGACTGCTGTTTTGCAGTGTTCTGGTGAACAAGGTGCCACAATATCCACGATACCCCCGAATCTGGGGGCGAACGTGTGTGTCACAAACTATAACGGTAAAGAAAGTGACAAGAGCTGCAGGATTGAAGGCAGCACAGACGGCGCAGAAACCGCGCTCAAAGAACTCCTGGGGACAACCCGCGATATCACGTGGACGAAAAAAACTGTCAACGAGATCTCAAAAGCCTCGACCCCCACAGATTGGAGCTTAGAACTACTGGATTCAGATCTGCCTCTATCCGAGAAGGCCTTCTTCGTCGGCTGTCAGCAGACTACCGGGACTGACAAACGTGCACGGCAAACGAAGTCGTGTACTGTAACAGTAAACGTCGACGCGAGAGATTCCGCTGTTGGGGCGAATAACGTGGTAACCTGCGCGTACGGTAAAAACAGCAATCCTGAGCCCCTGAAGGTTGTGATGACAACAG...

no. 1 example

[0077] Animal Immunization Test of the Gene Adjuvanted Recombinant Adenovirus Vector Vaccine Prepared in the First Embodiment of the Present Invention

[0078] Using BALB / c mice as experimental animals, 45 BALB / c mice were randomly divided into 3 groups, 15 mice in each group, Ad5-NcSRS9-IFN-γ vaccine group, pVAX1-NcSRS9-IFN-γ plasmid group and the PBS control group, intramuscularly inoculated once every 2W, and inoculated 3 times in total. Among them, pVAX1-NcSRS9-IFN-γ refers to the subcloning of the NcSRS9-IFN-γ tandem gene into the pVAX1 eukaryotic expression vector, pVAX1-NcSRS9-IFN-γ was constructed and preserved by the Preventive Veterinary Medicine Laboratory of Yanbian University, and introduced The immune effects of vaccines prepared with different expression vectors were used for comparison. The immunization program and dosage are shown in Table 1:

[0079] Table 1 Immunization schedule and dose list

[0080]

[0081] Before each immunization and 2 weeks after...

no. 2 example

[0083] Challenge experiment of neospora canis from bovine origin

[0084] Two weeks after the third immunization, the remaining 10 BABL / c mice in each group were intraperitoneally challenged with 10 bovine N. canis tachyzoites. 6 One, observe the clinical symptoms of the mice and count the survival rate, and evaluate the immune protection effect of the vaccine. After the challenge, it was found that the surviving mice in the Ad5-NcSRS9-IFN-γ recombinant adenovirus vaccine group did not show obvious clinical symptoms, while the pVAX1-NcSRS9-IFN-γ plasmid group and the PBS control group showed depression and hair inversion. Clinical symptoms such as erection and quadriplegia. Such as Figure 5 As shown, after 3 weeks of challenge, BABL / c mice inoculated with Ad5-NcSRS9-IFN-γ recombinant adenovirus vaccine had 80% survival rate, while pVAX1-NcSRS9-IFN-γ plasmid group and PBS control group were 60% respectively and 20% survival rate.

[0085] The bovine-derived Neospora caninu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a vaccine for prevention and control of neosporiasis of cattle as well as a preparation method and an application of the vaccine. The vaccine is a gene adjuvant recombinant adenovirus carrier vaccine, and the nucleotide sequence of a vaccine antigen is encoded as in SEQ.ID.NO.1. A preparation method of the vaccine comprises steps as follows: primers are designed according to open reading frames of an NcSRS 9 gene sequence and an IFN-gamma gene sequence of Neospora caninum, an NcSRS 9 gene and an IFN-gamma gene are amplified and spliced, a pMD18T-NcSRS9-IFN-gamma recombinant clone plasmid is built, a shuttle plasmid pCR259-NcSRS9-IFN-gamma and an expression plasmid H294-NcSRS9-IFN-gamma of a recombinant adenovirus are built, Ad5-NcSRS9-IFN-gamma recombinant adenoviruses are packed with QBI-HEK293 cells through lipidosome mediation and transfection, and amplification and purification are performed to prepare the recombinant adenovirus carrier vaccine.

Description

technical field [0001] The invention relates to the technical field of genetic engineering of parasitic disease vaccines, and provides a gene adjuvant recombinant adenovirus vector vaccine for the prevention and control of bovine neosporosis, a preparation method and application thereof. Background technique [0002] Neosporiasis is a protozoan disease caused by Neospora caninum parasitizing in the cells of dogs, cattle, sheep and other mammals. The disease mainly causes abortion, stillbirth or newborns in female animals. movement disorders and neurological disorders in children. In 1988, Dubey et al. isolated the parasite for the first time from a paralyzed dog and named it Neospora caninum. The ultimate host of N. caninum is the dog, and many mammals can be used as intermediate hosts. Its parasitic sites are the central nervous system, brain, liver, muscle and other internal organs. Neospora caninum is the most serious hazard to cattle and can be transmitted vertically. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61K39/015A61K39/39A61K47/46C12N15/861C12N15/30C12N15/23A61P33/02
Inventor 贾立军张蕾郭焕平刘明明丁德张守发
Owner YANBIAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com