A kind of porcine epidemic diarrhea recombinant baculovirus genetically engineered subunit vaccine and its preparation method and application
A technology for recombinant baculovirus and porcine epidemic diarrhea, applied in genetic engineering, botany equipment and methods, microbial-based methods, etc., can solve the problems of low effective antigen content, low expression level, poor immunogenicity, etc. , to achieve good immunogenicity, high expression level and high expression effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Construction of recombinant vectors Bacmid-S1p-M and Bacmid-S1
[0031] 1. Acquisition of PEDVS1 gene, S1 partial antigen gene and M gene: Design a pair of specific primers according to the gene sequence of PEDV newly isolated strain, the primer sequence is as follows:
[0032] S1-P1: 5'CGGAATTCCAAGATGTCACTAGGTGCCAGTCTA3'
[0033] S1-P2: 5'CCCTCGAGCTATCTAATACTCATACTAAAGTTGGTGGG3'
[0034] M-P1: 5'GAAGGCCTATGCATCACCATCACCATCACGATTA3'
[0035] M-P2: 5'CCAAGCTT TTA GACTAAATGAAGCACTTTCTC3'
[0036] S1p-P1:5'CCCTCGAG ATG GTACTTCTAACACTTAGCCTACCAC3'
[0037] S1p-P2:5'CATGCATGC CTAs AGGATCTGAGGAATTACTGCAAACA3'
[0038] The total RNA was extracted from the positive PEDV disease material, and each downstream primer P2 was used as the specific primer for RT; then the cDNA product was used as the template to amplify the whole S1 gene, S1p (partial epitope of S1 gene) by PCR technology. ) and M gene; wherein the nucleotide sequence of the coding gene S1p of the partial S...
Embodiment 2
[0043] Obtaining of Recombinant Baculovirus Bacmid-S1p-M and Bacmid-S1
[0044] 1.1 Recovery and subculture of Sf9 insect cells
[0045] 2. Transfect Sf9 cells with recombinant Bacmid-S1p-M and Bacmid-S1 plasmids by 2×10 5 Inoculate Sf9 cells on a 12-well cell culture plate at a density of 12, and transfect when the cells grow to 80-90% full, discard the old cell culture medium, and replace it with serum-free Grace cell culture medium; in sterile 1.5 Prepare the following solutions in a mL centrifuge tube: Solution A: Dilute 1.6 μg DNA to 100 μL with GRACE Incomplete Cell Culture Medium; Solution B: Dilute 4.0 μL Lipofectanmine 2000 to 100 μL with GRACE Incomplete Cell Culture Medium; Mix Solution A and B. Stand at room temperature for 20 minutes to form a complex of liposome and DNA; slowly add the complex of liposome and DNA to the cell surface drop by drop (do not discard the nutrient solution); after 4-6 hours, put the transfection solution into the The cell culture medi...
Embodiment 3
[0046] The preparation of embodiment 3 vaccines:
[0047] After the recombinant baculovirus Bacmid-S1p-M and recombinant baculovirus Bacmid-S1 were obtained through Example 2, the M protein and the S1 protein were expressed using a virus expression system. The step is to expand the culture of recombinant baculovirus Bv-S1p-M or recombinant baculovirus Bv-S1, purify and recover to obtain S1 protein or S1p protein and M protein; expand the culture to obtain recombinant baculovirus Bv-S1 with a suitable titer After the virus, when the cells are in the mid-log phase (the density is 1-2×10 6 Cells / mL) were inoculated with infected cells, and the insect cells were cultivated under serum-free conditions, which would facilitate the purification of the target protein in the later stage. However, generally according to needs, 0.1-0.5% FBS or BSA should be added at the late stage of infection to protect the recombinant protein from hydrolysis. After the cells were inoculated with the r...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap