Primer group, kit and method for rapidly identifying 1 type dengue fever virus
A dengue virus and kit technology, applied in the field of detection and identification of pathogenic microorganisms, can solve the problems of expensive equipment, low sensitivity, low sensitivity, etc., and achieve the effects of high specificity, high sensitivity and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Establishment of the RT-LAMP kit for rapid identification of type 1 dengue virus
[0033] RT-LAMP kit for rapid identification of dengue virus type 1, including the following components: (1) specific primer set; (2) reverse transcriptase; (3) DNA polymerase; (4) RT-LAMP reaction solution; (5) Chromogenic reagent; (6) Positive control and negative control.
[0034] (1) Design of specific primers:
[0035] Six specific primers were designed according to the specificity of the NS1 region of dengue virus type 1 (GenBank accession number: EU848545.1), and the sequences are as follows:
[0036] Internal primer 1: 5'- CATCCTGTCTGAAGCATTGGCTGGACAATTGACATGGAATGATC-3' (SEQ ID No.1);
[0037] Internal primer 2: CCTAGCTCTGATGGCCACTTTCTTCTCTAGATGTTAGTCTGCG (SEQ ID No. 2);
[0038] Outer primer 1: 5'- TGTGTTCCTCCTTCTCATAATG -3' (SEQ ID No.3)
[0039] Outer primer 2: 5'-CAGACTCAATCCAATCGTAAGA-3' (SEQ ID No.4)
[0040] Loop primer 1: 5'- CCAACCATGATGCATAACCTG-3' (SEQ I...
Embodiment 2
[0048] Example 2 Rapid Identification of Type 1 Dengue Virus Using the Kit of Example 1
[0049] Proceed as follows:
[0050] (1) Extract template RNA: Extract sample RNA with a viral RNA extraction kit;
[0051] (2) Loop-mediated isothermal gene amplification reaction: 25 μl reaction system contains: 8 pmol / μL each of inner primers 1 and 2, 1 pmol / μL each of outer primers 1 and 2, 4 pmol / μL each of loop primers 1 and 2, RT -LAMP reaction solution 12.5μL, DNA polymerase 8U, RNA to be tested 1~100ng, reverse transcriptase 1U, make up to 25μL with sterilized deionized water, then add 20μL of sealing solution, put the above reaction tube at 63~65 ℃ reaction 60~90min;
[0052] (3) Judgment of results: Add 1-2 μL of chromogenic agent 1×SYBR Green I to the above reaction tube, and observe the color of the reaction solution after mixing. If it is green, it is dengue type 1 virus, and if it is orange, it is non-dengue type 1 virus. (Such as figure 2 ).
Embodiment 3
[0053] Embodiment 3 specificity experiment
[0054] Using the method of Example 2 to treat 2 kinds of herpes viruses (HSV, EBV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), type 1 dengue virus (DENV1), and type 2 dengue virus (DENV2) , Dengue virus type 3 (DENV3), and dengue virus type 4 (DENV4) were detected, and DEPC water was used as a negative control.
[0055] See the test results image 3 . Only the dengue virus type 1 tube is green, the rest of the tubes are orange. The results show that the detection kit of the present invention has high specificity and can accurately distinguish type 1 dengue virus from type 2, 3, 4 dengue virus and other non-related viruses ( image 3 ).
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com