Supercharge Your Innovation With Domain-Expert AI Agents!

Primer group, kit and method for rapidly identifying 1 type dengue fever virus

A dengue virus and kit technology, applied in the field of detection and identification of pathogenic microorganisms, can solve the problems of expensive equipment, low sensitivity, low sensitivity, etc., and achieve the effects of high specificity, high sensitivity and good specificity

Active Publication Date: 2013-06-26
SUN YAT SEN UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The commonly used ELISA and immunocolloidal gold methods for dengue fever detection are time-consuming. It usually takes 5 to 7 days for the serum to reach the level of antibody detection. At the same time, dengue fever antibodies have cross-reactions with other flaviviruses, and the false positive rate is high. Therefore, serological testing The detection of dengue virus has relatively large limitations; the isolation of DV can identify dengue virus well, but it also takes a long time and has low sensitivity, and it cannot be used as a means of early detection of dengue virus
The DV nucleic acid detection technology developed in the past 10 years has provided the possibility for the early diagnosis of dengue fever, but both PCR and RT-PCR require expensive PCR machines as the basis, which also limits the use of PCR methods in identifying dengue viruses to a certain extent. develop
[0004]Although the above methods may provide better clinical value, they are different due to time-consuming, cumbersome operation process, low sensitivity, and expensive equipment. The reason why it has not been widely used clinically
Loop-Mediated Isothermal Amplification Technology (Loop-Mediated Isothermal Amplification, hereinafter referred to as LAMP method) is a gene amplification technology developed by Eiken Chemical Co., Ltd. in Japan around 2000. With the advantages of safety and reliability, the LAMP method has not yet been applied to the rapid identification of type 1 dengue virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group, kit and method for rapidly identifying 1 type dengue fever virus
  • Primer group, kit and method for rapidly identifying 1 type dengue fever virus
  • Primer group, kit and method for rapidly identifying 1 type dengue fever virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Establishment of the RT-LAMP kit for rapid identification of type 1 dengue virus

[0033] RT-LAMP kit for rapid identification of dengue virus type 1, including the following components: (1) specific primer set; (2) reverse transcriptase; (3) DNA polymerase; (4) RT-LAMP reaction solution; (5) Chromogenic reagent; (6) Positive control and negative control.

[0034] (1) Design of specific primers:

[0035] Six specific primers were designed according to the specificity of the NS1 region of dengue virus type 1 (GenBank accession number: EU848545.1), and the sequences are as follows:

[0036] Internal primer 1: 5'- CATCCTGTCTGAAGCATTGGCTGGACAATTGACATGGAATGATC-3' (SEQ ID No.1);

[0037] Internal primer 2: CCTAGCTCTGATGGCCACTTTCTTCTCTAGATGTTAGTCTGCG (SEQ ID No. 2);

[0038] Outer primer 1: 5'- TGTGTTCCTCCTTCTCATAATG -3' (SEQ ID No.3)

[0039] Outer primer 2: 5'-CAGACTCAATCCAATCGTAAGA-3' (SEQ ID No.4)

[0040] Loop primer 1: 5'- CCAACCATGATGCATAACCTG-3' (SEQ I...

Embodiment 2

[0048] Example 2 Rapid Identification of Type 1 Dengue Virus Using the Kit of Example 1

[0049] Proceed as follows:

[0050] (1) Extract template RNA: Extract sample RNA with a viral RNA extraction kit;

[0051] (2) Loop-mediated isothermal gene amplification reaction: 25 μl reaction system contains: 8 pmol / μL each of inner primers 1 and 2, 1 pmol / μL each of outer primers 1 and 2, 4 pmol / μL each of loop primers 1 and 2, RT -LAMP reaction solution 12.5μL, DNA polymerase 8U, RNA to be tested 1~100ng, reverse transcriptase 1U, make up to 25μL with sterilized deionized water, then add 20μL of sealing solution, put the above reaction tube at 63~65 ℃ reaction 60~90min;

[0052] (3) Judgment of results: Add 1-2 μL of chromogenic agent 1×SYBR Green I to the above reaction tube, and observe the color of the reaction solution after mixing. If it is green, it is dengue type 1 virus, and if it is orange, it is non-dengue type 1 virus. (Such as figure 2 ).

Embodiment 3

[0053] Embodiment 3 specificity experiment

[0054] Using the method of Example 2 to treat 2 kinds of herpes viruses (HSV, EBV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), type 1 dengue virus (DENV1), and type 2 dengue virus (DENV2) , Dengue virus type 3 (DENV3), and dengue virus type 4 (DENV4) were detected, and DEPC water was used as a negative control.

[0055] See the test results image 3 . Only the dengue virus type 1 tube is green, the rest of the tubes are orange. The results show that the detection kit of the present invention has high specificity and can accurately distinguish type 1 dengue virus from type 2, 3, 4 dengue virus and other non-related viruses ( image 3 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group, a kit and a method for rapidly identifying a 1 type dengue fever virus. The detection primer group comprises a pair of outer primers, a pair of inner primers and a pair of loop primers; and the detection kit comprises primer liquor, reaction liquor, DNA (deoxyribonucleic acid) polymerase, reverse transcriptase, a comparison agent and a color developing agent. The detection method comprises steps that: a sample RNA (ribonucleic acid) template is amplified through extracting a virus RNA to be detected and utilizing the reverse transcription activity of the reverse transcriptase by adopting six specific primers and the DNA polymerase with the strand displacement activity at 60-65 DEG C, and whether the sample RNA template is required to be amplified or not depends on the color change in a reaction tube in which the color developing agent is added. The method has the advantages of being efficient and rapid, convenient to operate, convenient to identify, having high specificity and sensitivity, and being applicable to detection at site, and the like, thus being applicable to promotion and application.

Description

technical field [0001] The invention relates to the detection and identification of pathogenic microorganisms, in particular to a method for rapidly identifying type 1 dengue virus by using a loop-mediated isothermal gene amplification technique (LAMP technique). Background technique [0002] Dengue virus (DV) is a flavivirus-like RNA virus, mainly including virus types 1-4 (DV 1-4). Dengue virus is mainly transmitted by the Aedes aegypti mosquito ( Aedes aegypti ) and Aedes albopictus ( Aedes albopictus ), dengue virus infection can cause dengue fever (dengue fever, DF), and severe cases can also lead to dengue hemorrhagic fever (Dengue hemorrhagic fever, DHF) or dengue shock syndrome (Dengue shock syndrome, DSS). DV is widely popular in the tropical and subtropical regions of the world. Our country is mainly distributed in Guangdong, Hainan, Guangxi, Fujian, Taiwan and other provinces (autonomous regions). Since the outbreak of dengue fever in Foshan City, Guangdong Pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCY02A50/30
Inventor 黄曦胡胜锋李淼钟兰兰
Owner SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More