White spot syndrome virus detection kit and method
A white spot syndrome and virus detection technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of inability to detect virus-carrying shrimp, low sensitivity, and long detection process time.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0090] The white spot syndrome virus detection kit includes an amplification reaction solution containing primers; the primers are preferably as follows:
[0091] 1F3: gttattaggattcagtagttctgt SEQ ID NO:1
[0092] 1B3: cctgacttgttccattggt SEQ ID NO: 2
[0093] 1FIP: gcaagggctctacatcacatcataaatattcctagacaacacgtcttg SEQ ID NO: 3
[0094] 1BIP: ccgtgcctcaatatatacccctaaatctttctactaagatttccaacc SEQ ID NO: 4
[0095] The amplification reaction solution also contains detection probes selected from the following group:
[0096] 1BD:BIOTIN-ctcgactaatcgtacaga SEQ ID NO: 21
[0097] 1FD: FITC-ccttgataatcacggttgcc SEQ ID NO: 22
[0098] Further comprising the positive control; the nucleotide sequence of the positive control: acagttggct gctgctgctg ctgttccttg attgactcca tttttagaat attgggttat taggattcag tagttctgtt attcctagac aacacgtctt gtctgtacga ttagtcgaga tgatgtgatg tagagccctt gcccgtgcct caatatatac ccctcagtag accttgataa tcacggttgc caaacaacaa cggttggaaa tcttagtaga aagaaccaat ggaacaagtc aggataataa tataca...
Embodiment 2
[0124] A kit for detecting white spot syndrome virus, including:
[0125] Sample lysate; (the solution configuration method is: 60~240g GuSCN dissolved in 50~200mL 0.1mol / L Tris-HCl (pH6.4), add 10~40mL 0.2mol / L EDTA, pH8.0 and 2~6mL Just mix TritonX-100)
[0126] Proteinase K; (Prepare a solution containing 50mmol / L TRIS-CL (PH8.0), 1.5mmol / L calcium acetate and 50% glycerin. After autoclaving, the mixed solution dissolves proteinase K powder to a concentration of 20mg / ml, Store the prepared proteinase K solution at minus 20 degrees.)
[0127] Sample cleaning solution; (The components of the solution are: 50~85% ethanol and sodium acetate with a final concentration of 3~300mmol / L)
[0128] Nucleic acid eluate; (20mmol / L TE solution)
[0129] Sample enrichment column; (purchased from the market)
[0130] Constant temperature amplification reaction solution; (the ingredients are as follows)
[0131] Reference Sample (including positive and negative control); positive control for the synt...
Embodiment 3
[0155] According to Embodiments 1 and 2, this embodiment specifically discloses a usage method. Due to space limitations, the recipe, sequence, etc. are not repeated here.
[0156] One. Sample extraction:
[0157] 1. Take 5~100mg of the tissue to be tested (fresh or -70℃ and tissue preserved in liquid nitrogen) and place it in a mortar, add 1ml of saline to grind to a slurry, transfer 0.5ml of the slurry sample to a 1.5ml centrifuge Tube
[0158] 2. Add 0.5ml saturated phenol, mix upside down, 10000RPM, centrifuge for 10 minutes, separate the water phase and the organic phase, carefully pipette the upper aqueous phase containing nucleic acid into a new 1.5ml centrifuge tube;
[0159] 3. Add an equal volume of phenol: chloroform: isoamyl alcohol (25:24:1), mix upside down, 10000 RPM, centrifuge for 10 minutes, take the upper layer and transfer to a new 1.5ml centrifuge tube;
[0160] 4. Add an equal volume of chloroform: isoamyl alcohol (24:1), mix upside down, 10000 RPM, centrifuge fo...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com