Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

White spot syndrome virus detection kit and method

A white spot syndrome and virus detection technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of inability to detect virus-carrying shrimp, low sensitivity, and long detection process time.

Inactive Publication Date: 2013-05-08
杭州三合创新科技有限公司 +1
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Electron microscope detection method can directly observe the virus particles, but the detection process takes a long time, the operation is complicated, and the accuracy is low; TE staining and pathological sectioning method are both to observe the processed tissue samples under the microscope, which has low sensitivity and human subjective factors It has a great impact on the test results; the antibody detection method directly detects the virus-specific protein, and the nucleic acid probe method can directly detect the virus nucleic acid, but the sensitivity of these two methods is not ideal, and usually cannot detect potential virus-carrying shrimp without symptoms; PCR detection The method is a relatively widely used detection method at present, but it requires professional experimental equipment and professional operators, and cannot achieve relatively fast and accurate detection of WSSV, let alone rapid on-site detection of viruses, which greatly limits the use of PCR detection methods in production. Promoted Apps in

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] The white spot syndrome virus detection kit includes an amplification reaction solution containing primers; the primers are preferably as follows:

[0091] 1F3: gttattaggattcagtagttctgt SEQ ID NO:1

[0092] 1B3: cctgacttgttccattggt SEQ ID NO: 2

[0093] 1FIP: gcaagggctctacatcacatcataaatattcctagacaacacgtcttg SEQ ID NO: 3

[0094] 1BIP: ccgtgcctcaatatatacccctaaatctttctactaagatttccaacc SEQ ID NO: 4

[0095] The amplification reaction solution also contains detection probes selected from the following group:

[0096] 1BD:BIOTIN-ctcgactaatcgtacaga SEQ ID NO: 21

[0097] 1FD: FITC-ccttgataatcacggttgcc SEQ ID NO: 22

[0098] Further comprising the positive control; the nucleotide sequence of the positive control: acagttggct gctgctgctg ctgttccttg attgactcca tttttagaat attgggttat taggattcag tagttctgtt attcctagac aacacgtctt gtctgtacga ttagtcgaga tgatgtgatg tagagccctt gcccgtgcct caatatatac ccctcagtag accttgataa tcacggttgc caaacaacaa cggttggaaa tcttagtaga aagaaccaat ggaacaagtc aggataataa tataca...

Embodiment 2

[0124] A kit for detecting white spot syndrome virus, including:

[0125] Sample lysate; (the solution configuration method is: 60~240g GuSCN dissolved in 50~200mL 0.1mol / L Tris-HCl (pH6.4), add 10~40mL 0.2mol / L EDTA, pH8.0 and 2~6mL Just mix TritonX-100)

[0126] Proteinase K; (Prepare a solution containing 50mmol / L TRIS-CL (PH8.0), 1.5mmol / L calcium acetate and 50% glycerin. After autoclaving, the mixed solution dissolves proteinase K powder to a concentration of 20mg / ml, Store the prepared proteinase K solution at minus 20 degrees.)

[0127] Sample cleaning solution; (The components of the solution are: 50~85% ethanol and sodium acetate with a final concentration of 3~300mmol / L)

[0128] Nucleic acid eluate; (20mmol / L TE solution)

[0129] Sample enrichment column; (purchased from the market)

[0130] Constant temperature amplification reaction solution; (the ingredients are as follows)

[0131] Reference Sample (including positive and negative control); positive control for the synt...

Embodiment 3

[0155] According to Embodiments 1 and 2, this embodiment specifically discloses a usage method. Due to space limitations, the recipe, sequence, etc. are not repeated here.

[0156] One. Sample extraction:

[0157] 1. Take 5~100mg of the tissue to be tested (fresh or -70℃ and tissue preserved in liquid nitrogen) and place it in a mortar, add 1ml of saline to grind to a slurry, transfer 0.5ml of the slurry sample to a 1.5ml centrifuge Tube

[0158] 2. Add 0.5ml saturated phenol, mix upside down, 10000RPM, centrifuge for 10 minutes, separate the water phase and the organic phase, carefully pipette the upper aqueous phase containing nucleic acid into a new 1.5ml centrifuge tube;

[0159] 3. Add an equal volume of phenol: chloroform: isoamyl alcohol (25:24:1), mix upside down, 10000 RPM, centrifuge for 10 minutes, take the upper layer and transfer to a new 1.5ml centrifuge tube;

[0160] 4. Add an equal volume of chloroform: isoamyl alcohol (24:1), mix upside down, 10000 RPM, centrifuge fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a white spot syndrome virus detection kit and method. The white spot syndrome virus detection kit is combined with the advantages of rapid nucleic acid extraction, LAMP (Loop Mediated Isothermal Amplification) and nucleic acid immunochromatography test strip detection, and no expensive instrument and apparatus are needed in the whole detection process; and meanwhile, the detection is carried out by a nucleic acid immunochromatography test strip method, and thus the detection reliability and the easiness in result judgment are improved. The white spot syndrome virus detection kit is low in detection cost, convenient to use and safe to humans and environment, and the method can replace existing relevant detection methods. The white spot syndrome virus detection kit can be used in outdoor production sites and different levels of laboratories, and has popularization and application values for reinforcing the monitoring of white spot syndrome viruses, immediately finding and controlling virus transmission, finding and preventing large-scale breakout of epidemic diseases as soon as possible, and the like.

Description

technical field [0001] The invention relates to a detection kit and a detection method for detecting related viruses in aquaculture, in particular to a detection kit and a detection method for detecting white spot syndrome virus. Background technique [0002] White Spot Syndrome Virus (WSSV, white Spot Syndrome Virus) has become the main pathogen of cultured prawns, and it is also the animal virus with the largest genome (about 290kD, double-stranded circular) discovered so far (Yang 2001; VanHulten 2001a). The virus was first detected in Taiwan, then quickly spread to other countries in Southeast Asia and then North America. It can infect not only prawns, but also other freshwater and seawater crustaceans, such as crabs and crayfish. After the cultured prawns are infected, the cumulative mortality rate can reach 100% within 3 to 10 days, causing huge losses to the prawn farming industry (Huang et al. 1995a; VanHuten 2001a). [0003] WSSV was the main viral pathogen of the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 石坚钱冬徐锦余
Owner 杭州三合创新科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com